TTHERM_00732770

Length: 3759 bp

cDNA Sequence

ATGAAAGATGCAAGTAAACTTTTATCAACAAAAAGATAAAAATTTAGCAGAACGATTATCAATGAAAAGTTCTATTTGTAAATTTCTAATGAGTTAGAAAATGAACTTGTAAACAATGAAAATGAAAACTCAAACCACCCTGAATTTTTTGAGTATCCATTTTAAATTGAAGTTTTAGAAAAAGAGGATGGAAGAGTAAAATTTAGATCTTTAGAATAATTGGTGAAGCTTATAAAGTACTTTAGGTTAGAATCAAATGTTTCATAGGATCTTATAAGAAACTATCTTGGATTAAAAGAAATGAAACCTGTTAATTTCGTGAAACATGATAATTTATTTAAATCATTAGATCTCATAATTTTATATACTACTAAGTTAGTAGATAAATTCTTTTCTAATTACTATGCGGATGATTATAAAGAAATTTTGTTAAAAGAATACAAATTCAATAAAATTAAAAGATATTTTCATAAATCTATATTTTAAATATAATTTTTACCTTGTGATTTCTATGAAGTTGAGCAAAATTTGATATAATCAAAAACAGATTTGATAACAGATAAGTAAAAGCAAGATTTTTAGATTTGGAAGCAATTTTTGAAGGTAAAAGGAACAAGAGATATCAATGTTTTCTTAGAAAAGTTTAATTTGAAAGAAGAAACATATACTGAAGCAGCATAAATTTAAGAATTTATTAATAAAACTACTAATAATTATTATATAGATAATAATAAAACTTGTCCTAAACCACTAAAAGGAAAACCTTAAAGAATTATTGTTGAAATGAGAGACATAGATGGAAAGATGAGATTGGCAACTAAAGATTCATATTACAAACATTTAAATTATTTGTTTAAGAATAGTTATTCAAATAATAATTTAAATAACATGATAATATAGTGTTACAAGAATAAAATTATTACTCTCTAACCTTTGCTCTGCTTCTACATAGATATAAAAGATTTGTGTTAAAACATAAGCTACAAGTTGATAAAAGACCTAAAGCTATATAAAATTGAGTAATATCTTTAGAACAGAAAAGTTTATCACTTTGACATCAAAAATAATAAAAAAGTTCCTCTAAATGTTAATAAAGGTATTTTCATTGGTGAAGTATTTACCCCTTATGTCGTAAATAAGACCCTGAAAAAGCAAAAAATCTTATTACACAATTTAGAAATTTATAAATTTTAAGATGACTACTTAATAAAAGTATTTGATTCAGAGTAAGCTTTATACACATCCAAGAAGTTTGTTAATTATCTTTAAAAGTTTGAAGATCCTTCTTTATCAGAATAGATCCTTTAAGATATCAAATTTGAATTATCGAAGGTTGGCTTTGAATATAATGAGTAGAATATTAGAAAGTTATGGTCACTTAATGGTGAAGGAAAATTGACTGACTGCGATAATTTCTAAATGTTTAAATAAAATATGCTATAGCATGATGAAATATAAGAAAATGTAACAGAATATAAGGAATTTATAAATGGTCTAATAAAAAAATATACAGAAAATTAAGATTTTTTATCATCCTATTCTGAATTGGAACTCTTTGCTATTTAAAAAATGATCCAAAGAACTCTTAAATTTTTTGATGAAGAGGATATCTTAAATTTAATAAAAATTATTGTTTAAAAATATCAATAATCAGAAGGATTTATTTAAAATAAATTCGCTTCAACACCATTTCCAACTATGTCTTATTCTAAATAATTTTCAGTTAACGAATTCTTTAAACTATCCCTTGAATAGTATTTATTAGTAAAATGCTCACTTGTAAAATTGGCTCTAGATGAGGCTCAAAAAAATGAGGAAAAGAAGCAAATTATATTAGATTATATCAATGATTTCATAGGCTTTAGTAAACATGTTTTAGGAAAAAATTGTAAAAACCCGTAAATTTTAATCGCTGAAATCTTAGAAAAATTATTGATAGTAGACATCTAATTATTGAGAAAGAAAGAAGATGAATTCCCTAGAGATATAATTAATAGATAATTTAAATTAAATCTTCTTTAATTTGAGAGAATGGACTTGCACATTATCTAATTATTTACGCGCCTTTAGTGTTTAAAGCTCATGTATGAGTATTTAACAGTAGCTGAAAAGGTTCCTAAGGGATTTAACTATCGTGAAAAGTTCGATAGTGATTTAGTTAAGCATATTGATCAAATAAAAGTTTATATTAAAATGAATTTTAATAATTCTAATGAAGGAGATGCTCATATTATTAAGATATTTAAAATTCTATTACTAAACTGTACTTGCATAGAGTTCTACACCTTTTTGCATAATTTTACTATAAGATAAGACCTCAGTAAGGAAGTTAAAAAATTTGTTAGACAGGAATATGAAAATTTAAGACAAAAGTATTGTGAGAAATAAATTTAGTACCAAAATTAAAAGATGCTTCAATCGCTAAATGATGAACACTCAAAATCACAAGTATAAGTGCAAAATTAATTATTTAATAGCAACAATAATTCAAATCCTTCTTAATTAGTTTTTCTTGAGGGAAATTCTCAAGGTAGTGAAAATTTTTGCAATATCGGAGATGAGAATAAAAAAAACAATAATAATAATAACTAACGCCAGCGCAGGCAATTTAATGCCATTTTTATTGGTAATAAAAGCAACAATCAAAATTAGCAATTATAGTAGGAATTGCTAAATGATAATAAGATTGTGCTATAAAATAAACTTTAATCAAAATCTTAATATTTTTCTTCAATGAATTGTGAAAATTCTGTCAATAGATTGATGGAAGAAGAAAATTCTGTCAATTAATCAATTCATTACTAATCTGAAAACAAAAGTCTTATATAGAATGATAATAAAAATGGAGAGTACTAGAGTCGTGTGACTCACTCAGAAGAAAATACTTAGTTCAATTTAATTAATTTTAAAGGATTGATAAATAATATTAAGAGTTAGGATTAAGGTGATAAAATGACAGAACCAAACACTGAATGCAAATTAAATAAATAAAAATTTATTAGCGTTAACAACTCATTTTATTCAAAAATAAATCCAAATGAGAATTTTAAAGAAGAAAAGAAAGCATCATTAAATATTTAGTAATCATTAAGTGATGAGACAATCAAATAAAATGACTTACAATTGAAAAATTTAAATTCTGTTAATGATAGTAATAATAATACTTTCTTACAATATAATAATGAATCTGAAGATAACATTGAAATTGCAAGAAGAGTCAGTTCTTCTAGCTGCTAAAATGGCTCTAAAATATCTAATTCTTCAAACTTGATAGGCTCTATTATCAACATTAATAATTAAAAAAATATACCTGCTAGCAACTAGCGTTAGCTATCGAAACCTATTTAGAGTGGTAGAACTATTTACCATGCTTAAAATAAAAAAATATAAAGAAATTCATAAATAAAAAGTAATAATCCTAGTTCAAAACTTCTAAGAAGTAGCTCCAAAAATAACACAATTGATAGTAACAGCAATAATTAAAATGACATTATCTCGAAAGCAGCCAAAATACTCATGTAAGAGCAGGATTAAAAGAAATCAGCTAAGCTAAAAGTGATGAGCAGAGAATCTAAAAAATATCAGTAAAGTGAGAGTTTCGGGTAATCTGCTGCAAAAACATACAAAGCACCTTCTTCTCAGGAGAACTTTTTAGAAGGATTCCAAAATATAAATAACAACAACAACACCACCCATCATTAGTACCAAAGTGAAGACGAAAATTCATTACCCTTAAATTATATGTGGGGTCATAACTGA