TTHERM_00752220

Length: 663 bp

cDNA Sequence

ATGAAATCGTCTAATTAGACTCAGATTTATAAATCTGATTTTCAAATTCTAAAAGAGCATCATAAATTCCTTAGAGATGATGAAAAAGATAGCCAAATTTAATACAGTAATCCCACTCAGGAGTAATATGGCGAGATATTAGCAAAAAAGTACTATGAAAAGCTTTATAAAGAGTATGCAATCATTGATTTATCTAGATATGAAACAGGATAGATAGGCATGAGATGGCAGACTAAAGATGAAGTTATCATTGGTAAAGGAATTGTCATCTGCTCAAATAAAAAATGCACCAACACTCAAAATTTGGACAGTTATGAAGTTAACTTTGCTTATGTTGAAGATAATGAAAAAAAAAATGCTCTAGTCAAGGTGAGGGTCTGCCAAGAATGTGTGCTTAAACTGAATTATAAAAAATAACACCAAAAAGTAGAAGATAAAAATTTTGAGCATTCCAGTCTTACAAATTAATAGCAGTAGCCTAATCAAAACAATGAATAATCTGGTAATTTAAAACAGCTGAATGAAGTGCAATAAAATAATCAGCATGATAAAAAACAAAAAAAAACTGAAAATGATCATTTAGATGTCCAAAGAAAAATTAAAAAAGATAAAAAGAAGAAGAAGAAACACAAACATTCTAAAAATGATGATGAAGATGAATGA