TTHERM_00753570

Length: 387 bp

cDNA Sequence

ATGAAATAATTTGCCTTATTGTTTCTTGCTTTTGTTGCTATTAATACTGTTAATGCCTACATAAGTCAAGATTAAATAAACTAGTTTAATAATTGCACAGATAACATAAAAGTCACTTGCACTTCCGAGAATATTGTTCCTTGCAGAAATTCAAAGATTGATATTGATACTTGCTTAAAAAGTTGTATTGGAGATTTAAAATCATAAACTATGGGTGGAGTGAAAATTTGTTTTGATCAATCATGTTTACCCATCGCTAAAAATAGCACAATCGTTAGTATCTAATAATATGGAAGTTAACTTGACATTTGTTTGAGCTCTGGAATTATTTCATTCGCTTTCATTCTCTTGGCTGTCATAGTTTCAGTTTTGTTTGTACAACATTGA