TTHERM_00753580

Length: 387 bp

cDNA Sequence

ATGAAATAATTTGCCTTATTGTTTCTTGCTTTTGTTGCTATTACTACTGTTAATGCCTACATAAGTAAAGATTAAATATACTAGTTTAATAATTGCACAGAAAAAATACAACTTCCTTGCGATAGAAGCAACACTGATTGCTTAAAATAAAAGGCTAAAGTTGAAGATTGCTTAGATTATTGTTTTGATGGAAATTGGAATACTCTATCTATGGGTGATGTAAATAATTGTTATTAAGATTAATGTATACCCTATGCTAAAAATAGCACGTAGAGTACTGTCAGAACCTATGCAAGTTAACTTGGCTATTGTTTGAGCTCTGGAATTATCTCATTCGCTTTCATTCTCTTGGCTGTCATAGTTTCAGTTTTGTTTGTACAACATTGA