TTHERM_00765120

Length: 2106 bp

cDNA Sequence

ATGGACATTGAAAACGAAGATAGGGAAGAAGCTATTCTTAGCAACAATGAAGATGATAATATAGAATAGAATGTGTAATAAAAGCGAGTGAGAGGAAGAAGAAAAAAGTAATAGTAGGGCTGGGAAGAAACTATTGAAGTAGTCATACCTGAATGTTTGACTAAAAAGGACTGTAACTAAGAAAAGAAAGAATAAAAACCAAAAAAGAAAAATAATTAGAATGCAGAAATGGAAATTGAAGAATATGGAAATCTGAAGGATAATTACAAAGATATATCAAAGCAAATTATTGATAAAAATTATAAATTTAAGCATCTTTTTGACATAATTGAATATTATAATATCACAATTGACAATTAAAAGGCTGAAATACAAAGAGAGAACTTTAAATATTTGATATAAAAAGTATTTAATATACTTAATAGTAAAATTTAGGATTTGCCTTTATTTTTAAACTATATCTAGCTCTTGATAGATAAATCGAATTTAGACTTACTATTAGAATTTAACGAATAATTAGAATGTGATATAAAAACAATGAGTGAAGATTAAGCATAAGAAATACACATTGTTAAATATTAAGGCGGCAATTAACTTTTTAAAATTTTAACACACTTTAAGTTTGAGGTAGAAAATATAATTTAAAAAATTAAATCGAAGAATAAATATGATTAGCCTCATTTAGTATTATGTGTATTTGATGGAGCTTATAATATTTGCAAATAAGATATGATCGATATTGGGAAGTTTTTCTTTGAAGAATATGAGCAATATTAAAATTTTATTCAATTAGTCATTTTATTTCCAGTAAGCTAACTTATTTCTATTCCAGATATTCAAATATACACTGTTGAGTTTTGCAAGCAAAAAGACTTATTTGTTAATTTTTTACTTTTTTTACTCAAATCAGAAGAATTTCCTCCTCTTCCTAAAAACTTACTAAGGGATATGTTAAATGAATTTGATTTGTACTCAATTACTTATAATGATTAAGTAAGGAGAGTTAAAATGGCTATTTCTAATTTTGTGTATGAGCATCAGGAAGATGAAGATTTAATAAAACTATTATAGTAAATGAAAGAATATGCCTTAAATTAGTTAGCTGGATAAAACAAACCATAAAGAAAATCTTAGAAGATTAGCTCCAATATATTAATTGATAAGTTAGACTTATGGACAAAAAAAAAGGAAATATAAATAATTATTGAATTTTTAGAGAGATTTTATGGTATGAATTTTTTTAATGGTGTATCAAATGAAGATAACTCTTTTTCGCAAAAACTCATTGATTAGAGTCATAGAATTATAGAAATTATTTTAAATGAAGATAAAAGGTATGTAATGACAGAAGCATAATAAAATGAATTTTTAAAAGATCCAAATATTTCATGCAAATCAATTTAATAGCTGTTAAAAAATTTCTGTGAAGATATAATAGGAAACTAAATATTCAAAATTCATGCACAAAACCTTTAAGATATTAATAAATAGGTAAATGATGATATATAAAAATTAAAAAGTTATAATCTTCATTCAAAAGATAGGTATGCAAAATCCTAATAAATTAGTAAAACTCAGTCAGAAAAAGACATTTCATAGCAAGCAAATCAAATGAAAAAGGAAAGAGTAGAAAATATAGTTAGGTAAATAACTTATGATTTGCATCAAACATTTAACATAATGGCAATTGCACGACTCTCTTTAGAAATTTCATAATTAAGCTCATAATGTAAGCCTGATATACTTGGCAGTTTGATGATACATAAAAAAATAATTGATCCTATGTATAATAACCATATCAGTTAAAATAAAAAGAAAAAATAGGAGATAGTTGAAAGTAATGCTGATGGATTGTATCTCATTCATATTTTAGAATAGTATGGAAAAAAATTCACAATTACAGAGTCATTTAAAGAATACAAATCTATCTTAAGAGAAAGAAAAATTGAATTAGATGAAGATGAGCAGCTAGCTTCTTACTATAACGCTATTTGTGAACTGAGATATCTAGGAATGATTGAAGAAAAGAGAAAATTAAAAAATGAGTTCATCAAGCATTTCTTCGCAAAATCTTCATATTTCCCGCTTAGCATGTAAAACAGTTGA