TTHERM_00770690

Length: 306 bp

cDNA Sequence

ATGACCTCCGTCTTCAAGAGATTAGTTCCCACCTTCAACAGAATCCTCGTTAAGAAGTTCGAAGCTGAAACCAAGACTAGAACTGGTATCATCCTCTAAGACCCTGCTGATAAGACTGCCTATGGTGAAATTGTTTCTGCTGGTCCTGGTAACTTTGACAACAATGGTAAGGTTATTCCTTTGGGCGTTAAAGTTGGTGATATAGTTGTCTTACCCGACTACGGTGGTTCCAAGATTAATTTAAAGGATGGTGAATTCTTTGTTTACAGAGATACTGATATCCTCGGTGTTCTCCACAAGAATTGA