TTHERM_00770740

Length: 618 bp

cDNA Sequence

ATGAAAACTCCATAAAAAAAAACATTTTCTTACTTACATATATCAAGAAAAATATTAGAAAAAGACGAATAAAAGCTAAAAAAAGCAAATGAAGCTGTTGAAAATAAAAACAATGCAAATAACAACTAAAATAATAACTCATCCAATGCTAATAACTAAGAAGAAAGTGATGAATATTTAATTAAAGAACTAGAAGACAAGAAGAAACAAAGATGTAAATATTATCCCAATTGTAAAAATGAAAAAACTTGCCCATACATTCATCCAACTGAACCTTGCACTTTCTTCCCTACTTGTAAGTATGGTTCTCAGTGTATAAATAAGCATCCTGATTGCAAATATGGTAAATCATGCCAAAGACCTGATTGTTTCTACGAGCACCCTTTCCCAAGTAAAAATAAATACAATTTTGAAGAAATTCAATTAACAATATTTTATTAAACAGAAAAGCAAGCCATAAATCCTTTCCTATAAATGTTAATGATGCCTATGATGAATGCCTCTAAGAGAAAGATTACTAATAAGCCAAACGGTAAAAGACCTTTCCCTGGAAACACCCCAGGATAATTACAAGGTGGTGAAGATTAAAAATCTGAAGATAAGCAATAATAACCTTGA