TTHERM_00773110

Length: 1404 bp

cDNA Sequence

ATGGGATACTAAGTCTTCTACATCAAAATCTTTTTGTATGATAGAAGTGTAAGTGATGTAAAGAGTGTTCAGAGCTCAGTTACCTAATCAGTAAAATCTAAGCCATATAAACCATTAAAATCCAAAAGAGTAATTAGCATTATTTAGATATGCTGGTTAAAAGAAATTAACTTCTCTTTAAAATAGGTTCACAATTAAGCAATATAAGAAGAGTTGAGAAACGTTTATGAAAAGTATAACACAAAGGAAATAGATGAAGTCTAACTAAAAAATGAATTGAAGCATAAATTATATATTAAATTGAATGATGATGATCTTGATAGAATGATAAGAAACAATGAGTTTAATTATAAATCACTAATTAAAATCTGTGAAAAAGATTATACTAAATCTAACTAGCCTATTACAACCAATTAAGAATATTTCTAAAAGTAAAATGAAGCACAGGTATAACATTCTTAAAATCTTTGGTAATATAGAAGATCTTAGGAAAAGCAGAAAGGTGAATTAAGAGTAGATGATTACGAGCAGAAAAAAATAGATGATTATAAAGAATATCTAAAGAAATATTAGTCTCCTGTAAGGTTTGATGCTTTAAATAAAGTAGATTAATTCTCTAAGGGACTATAAAATAAAGAAGAACTATTGAAAGATTTGTAAAGATATGAATTAGACTTAAAAGAAATTAAAGATTCTAAAGTAAGAGCTGAATAAAATATAGAATCAACTTATATTAAGAATAAAATATTGCATTAGTTTTAATAATAAGACTTATCTAGCATTAAATATTCACCAGCAAAGAATCCTAAATAATTTGTAGAGAACACTTCATCACTTTTTAAGCCTTTTAATGAAGCAGATAATATCAAGCCAAAGATCAAAAACACTTAAGATGATGAGAATAAAGCTATATTTAGTAGCAATGGTATAGTAAAATTAAGAACTTTAGGAAATGGATAGTTTTGTGAAAATGCAAGAGACAATGGAAATATAATTACTTGGCATACTTCTTAAGAAGATTATGTCAGAATTAATAAATAAAAATAATAGGAAGTAGAAAAAAATAGGTTAAGAAAAATGAAGAGTTGTGAATTTTTCCATTCAGGATTAGAAAGTGTTAATAATTAGCTTGTACCTTCTGTGAAAAAAAATCCTTATTAAAACGAAAACTAAAAATACGATTAATTATAAGAAAAAGTTGTATAATAATTTAAATAGACAGGTTAAATTGATAAATCAGTAATAGGAGATATTAAAAAGTAGTAAGAGAGGTGTTTTGTTTATGATGATTATGTCACTCCAGTCAAAATAAATTACTCTCATAGATATAAAAATAAGTAATAAATTTCATTAACTTCAAAAACATTTATTTAAATTGAATATAAAATAGTTATTAAGGGGTGA