TTHERM_00773500

Length: 579 bp

cDNA Sequence

ATGGACGCAGCTAAAAAAGTAAACAAATTCATAATGAAAAATCCAGAAAATGCTGACTTTAATTAGTATTGGTATTCTCCAAAGACTATCGAAATCTTAGTCAATCAGGTCTTGAAGCATGGTAAAAACTGTGCTTTCTTATCAACTCCTAGTATATTTTATTCAATTAATGATGCTCAGTTTTTGAAACAATGCTATGTTTTCGAGTTTGATAAAAAATTCGAGAAAAATAATCCTAATTTTGTTTTCTTTGATTTTCATAAACCTGAAGACATTCCTGCATAATTTCACAATTTTTTTGACTTCATTGTAATTGATCCTCCTTTTATAACTCGCGATGTTTGGGAAAAGTATGCCAATGCAGCAAAAATAATTGGTAAAAAAGATGAAAATAATAAATTTGTAGCCAATGTATTGGCATCTTCAATCGATGAAAACGATAAAATGTTAGATGAATTGCTTGGCCTTAAAAAGAGAGTAGCACGTCCTTTAATTCCTAATTTGGTTTACTAATATTCTTTATATTCAACATATGAAGATGAAAGCTTAAATTAAGTTAATGAAGAAATAGGATTTTGA