TTHERM_00773560

Length: 1053 bp

cDNA Sequence

ATGGAAGACTCTGCTTTATTAGAGAAATTAAAAGGATAAAAATGGGATCGCATAACAGCAGATGAAGACAAAGGTTTGAGACTTCTTCTCCCAGAATAAGGATAAAGCTAAAAAATCCCTTACATGTATAGCCCTTAATTGGTAATAAGCTTTGCAAAAAAAATTTAAGAGGAATAGATCATAAATGGCTTTTCAGCCCTTAAAAAATTAGGATTATTATAAGATTTGTAAATAAATGTTTTTTTGGATTTATTTGCAGATACACCAGCATTCAAAGATTTACTACAAAAAGTCTCCTATTAATTAGGGTAGCTTAAGGTGTTAAAAAATTTAAAGATTCTATAGGTTTAGTCTTATAGTTAAGGATAAGAATATCTTCTAAATGATATCTATAATATAGTTCAACTTCAGAATTTGGGTATTTAAGAATCATGGAGTATTCATTAAAACAATTCTAATTTATTGTTCGACAGTACTTATGCTAACTAATTTTAAATGATATTTAAATGCAGCTTTTTAAAGAGATTGAGCATAGATTTAACTAAAAATATCGAATGTAATGAATAATTCAAAGAAGAATTGAGAAAACTTCAAAATTTAGTTTAATTAGAGGAGTTCCATATTAATTCAGGCATCAAAAATGAATCTTTTTATGATTTGTTAGGATATCATTTATCTAAGCTTCCTAATCTCAAGCATTTAGGTATTGGAATCGAAAATAATGATATAGCTGAGGTTGGTCAATTTAGTAATAATATTATGAGACTTTCTTAAAATATTTGTAAATCACTTAGCATAGAATCAGTAACAATAAATACAGTTAGAATAGGAGAATAAGAAGTAGAATATAACTAAGCAATTGATTTTATTTCCTAAATAAAGCAATTAACTAAACTTAGAATAGTGGCTTTAAATCATAGCAACATATTAGATAAACTAAATTAATTTACTTCATTGCAGAGTCTTAATTTGGTTTTAGATAAAACTTTAAACACATTACCATTGGCTTATTTAGAAAATTAAAAAAGCATTACCTAACTTGGTAGAGTTTGA