TTHERM_00773690

Length: 1311 bp

cDNA Sequence

ATGTCAGTTGCTAAGTAAACCGCTAGATGCCTTAATGGCCTTAAATCCAACGTTGCAGTTGTCTTAGGTGCTCAATGGGGTGATGAAGGTAAAGGCAAACTTGTAGATATTCTTGCTGAAAAGTATGAATATTGCGCTAGATTCAATGGTGGTGCTAATGCTGGTCACACTATCATTGCCAATGGAAAGAAATACCCTTTCCACTTACTTCCTTGTGGTATTCTTTATCCTCACACCAAGAACGTTTTGGGTAATGGTACTGTTATCCACTTATAAACTATGTTCGAAGAACTTAAATAACTCGATAGAGATCACATCAACTACAAGGGTAGACTTCTTCTCTCCGATAGAGCACACTTGGTTACTTCCCTTACTATTGCTGCCGATTCTAAGAGTGAATCTTCTTCTAAGAATCAATTCCTTGGTACCACAAAGAGAGGTATCGGTCCTACTTATGCCAGCAAAATGAACAGATATGGTTTAAGAGTTGGAGATTTAAAGAATTGGGATACTTTCTTGTTAAAATACAAGTACCTCCAAGGAAAGTTTTCTGAATAAGGAGTTAATGCTGGTAGCGAAGAAGAATTGTAAGAAATCAAGTTATTAAGAGAAAGAATGCTTGCCAACAATATGATTACTGATACCGTCGTTCTTATGAATGAAGCAATTAAGCAAGGAAAGAGAGTTTTAGTTGAAGGTGCTAATGCTTGTTTATTAGATATCGATTTCGGTACTTATCCATATGTTACTTCATCCAACACATCAATTGGTGGTGTTTGCACTGGTTTAGGTATTGCTCCTCATCACATTGAAACTGTTATCGGTATTGTTAAGGCCTACACCACTAGAGTTGGAGAAGGTCCTTTCCCTACTGAATTGAATGATTAAAATGGTGAACATTTGAGAAAGGTTGGTCATGAATTCGGAACTACAACTGGTAGACCCAGAAGATGCGGTTGGTTGGATATTCCCTTATTAAGATACTCTCATATGATTAATAACTATTAATCAATAAATATCACCAAGCTTGATGTTCTTGATTAAGTTGACGAAATTAAAATTGCTACTAAATATACTGTCAATGGAGAAGAAATTCATTTCATGCCCTCAACTATTGAAGAGTTATCTTAAGTAAAGGTTGAATATACTACTGTCAAAGGATGGAATCAAGACATTTCTAAAATAAGATCTTATGATAAATTACCATAAAAAGCTAAGGATTATCTCAGCACAATTGAAGAATTACTAGGTGTTCCAGTTTCTTGGGTAGGAACTGGCCCTGAAAGAGAAGCTATGGTTCTCAAATAATGA