TTHERM_00773780

Length: 6165 bp

cDNA Sequence

ATGTCAAACACATGGAGAGCATTTATGTCGCCACTGCATGATGAAAAGTTAGCATTAACTAATAACAATAAGCAGGATGTTTCTTCTTTTGTTCTTTCTTCAAGGCAGACTCCACAGAAGAAGAAAGATCCCTCTATTTTAGGAAGTGGGTAGTTTAACGAAGGTCCTCCTACTTCAAAAACAAATGACTAACACTCTCAAAATGCATTAAAGTTTGCTGAAAATAACTCTTCTGAGATTAGAGAATAAATAGATGATATATAAAATAAAGTAGTAACTCTTAAAAAGAAAATTATGAGCACTTCTCCAGAATAATACCATTAAAATATTATTCACAAAAATTAGAACTCTTAGATTTTATAAAATTTTTAACAATAGCTGTCATAAGGATAGTAGCAACTATCTTTTGCATAGAATTTAAACTCTTAAAAAATTAACTAGCTTTCATAAATTCAAGGCCCTGCTACAGAGAGATCTACAGGAGGGTATATCTTAACAGATACAGAAAGAAGAAAATATAAAAAAATTAGTATCCTCCCAAATGAATTTACTTAGTACTCTACCGCAAGATCTGTATCTAATAAAGCAGGAAGTAGTTAGGTAAAAAAAAATAGTTTTTTAGAAGACCTCGATAACGCACATCTAATTGTAAACAACAATGTTAATCCATTCCTAATCTCCGAAGCAGGAGACTAATCTAGCCTCATGAGCAAACTCCTACCACATAAGCAAACAGCAGATGCTAATATACCATAAAAAGAAGAGCAGAACGAAACTGAGATGCTAAAAAGATGCATGTTAAAGATATAATAAAAGCTAGAAAAAGAAAAATAAAAAAGAAGAGAGCTGAAAATGTTGGTAAAACAATCTAATATGAGTATTGGAAACTTAAGATAAGATATAAACAATTATTAACTTGATATTCAGCTTGTAAAATAGCTAACTTTAAACACGACAAGAGCTATTGAAAGCAGAGTAAGTCAATCTAATCTTCGTCCTTCTACTACCACTGCTGCATAGTTAACAACAGCTAAAAAAAACCCAAACAATTCAATGTCTAAGTTATCCAAATCTAAAGAAAAACTTTTGAACTTAGTAAACATTTCAAATGTATAATAAACAAAGTAAAAGTCACTCAATGGCTTGAAAGTTTTTGCAAGAAGAAAATCTAAATCTGTGAGTAGCACAATAAATGATTTTAATAAATAAGGTATTCTCCATATAGATTTAAGCTCTCTTGATTCATCAGATAGCTCATAAGAAGAAATTTAACTAAATAAATAAAACAAATAACCAAACATTTCTAATAGCAAAAATCTTTCTTATCACCCTACTTATCTGAAAAGTGAAGGAGAGACAACTACACATTTATAATAAGCATAAGTTAAAAAACAATAAAAAAATCGCCTTAGCTAAGAGGTAAATACGTTTACTAATGAACTCAAACAAATCTAACAGTAGAAAAAAGAAAAAGCACAATATTACTTAAGCAAATTAGATAAAGGTAAAAAGCCTTCATTAATTGATACAAGCAGTAGTGTGAGCAGTAGCAATATGAGTGCATTGAAATTTTTACAATCAAATTAAATAAATTAAAAACCATCAAAATTGTAGAAAGCAACATCTAAAAGTACAAGTAAAATAATAAATACCAGCTCAAATGGTAAATCTACTTATAAACCAACTATCAACTAAGATAGCAGTAACATGATGATGAATTAAATTCTTGATTCTAAAGCATAGAATTTGTAACTTTGTATAAATACTTCTGGATCCTCTGTCGTATCGAATATACATACTCATCATTAGCAACCTATCTAGCGTAGTGAAAGCAAAGACATAATATAAAAGAAATTAAATGAATTCAAAAAATTTAAGGAGGCCTTAAATTCAGAAATTACAGAATTAAAAAAAGAATTTGATAGCAACGATCCTTTTCTCGCCTCTTTGAATTTTGAAAAACTCAAGGAAAAAGCCCTAAAAGATAAAAAGACTTTGCTTGGATTAGATAATTAAAATATAAACAATACTGGAAGATTTAATAGTGCATAACTGAATTAAAATTAGCATGAAGAAACTGAAACGGTTAATTATATGTATGAGAAAGAATAAAATAATGATTAAGATTTTTAGACACCAGTCACTCATGAAAGAGGACCATAATCAGATGCTACCACTCACTAAAAACAGAATATAAATCAATCTCATTGTAACAATAACAACCAGAGAACTGCTAGCAAAACTACAATTAGCGAATCTCGAGAAACAGCTTCATTTGAAAAATAAAAACAATAAATTCATTCAAAGAATTTTAGCAAAGAACTTCTTTCACCTTCAGAGGATATTTTAACTATACATCAAAATAACTCTCAAATTTAATAACAAAGTGGATAATTTTTGAGCAACATGCTCATGACTGAGTCATACACAGGAGATGAATACATAAATAGCGATAGAAAAAACACAAAAAGAAATAATACCTAAGAGAAATAAAAGTAAGAGTATAAAATGTTTTAGAATCAGTTAAACTATTTTAAAATGCAAGAAACTCTAAACAAGCATCTTCGTCAATATGAATCTGAAATCCTTGAAAAGTAGGCAGCTTAAGAAAATTAAAAATAGCTTAATTAGCAACAATCTTAACAAATAGATTAGAATTTTACTACAACTGGAAACCTAGGATCAATTTCTTCATCTGCACCTTCTGTTAAAAATAATTCTGATTTAACTGCTGAAAATTCTAAGAAGTAGACCTAAAACTTTCAAAATTTAGTTATGCAATAAAATAAGCAGCAAATGTAGACTCTTATTAAGTAACAGTAATAGCTTTTAGCATAATAAAATCAATGTACTTTTAATGTAAATCAAAACAACATTAGCCAAGAGAGTAGTGCAAGAAATTCATCACATATAACTCAACAGCACCAATAACAAAATAATAAATAATAGATTTTGAACTCAAGTGAAAAGAAAAAAGGAATAGATTTATGTAAGAAGCAGTTATTCCCTGAAGGAGCAGAATTTAGCGATGATGAATTCACTTAATAATAAAATAATTAAAATATTTAATAAATTTATCTTTAAAAATAATCTATTTGCAGCAACCCAGTGAATATAAATGATTACTCTACGAACGATAGTCAATAATAGTAACATATCCATAATTCAAGAGAAAAGTAAAAGTAGTTGACTTAATAGTAATCTTAATAAGTTGTCACGTAACCAAGATATATAGAGAACTAAAATGAAGTAATACTGAAATAAATAAAAAAGCAGTAAAATGAGTCACTTTTAGCTAACTAGTAATCACCGTTACAGCCTATGAGTTACATTTAACATTCAAACTAAAAAACAGGGTAGAATTCAACTCATAGCAACCAAACAGGTTAAATTAATGGAAGTTCAGGTTAGTAACAAAATACTCTGTTTTACAAGACCCCGTAAAATAGCAATAATTATAATACTAATAGCAATTCTAATTTAACAAGTGCATACTCCTCAACTGGTGGTAGTGTTAACATTAAAAATTTATCTCCTTAGCAATAATTACAACAAGAATAATTTATACTTTTCCTCTAACAAAGCAATTCCCATTTGCACCAATCTGGCTCAGGAGGATTTACTGATAGGTAATACAACAAAGGTTCAAATAGCTCAGAAAAAGTATACCCTTCAGGTGACACATTCACAAGTCCATTAATGAATTTAAAAAGCCCTGACTTGAATAAAAGCTAAAGTTAACTGAAGAAAAGTGGTAAAAACTCTGTTCCTTCCCTTCCTAAGAGTCCTAATTCAGTTATTAACTACTATTAAGATCCTATAAACTATAGCAATATTACTGGGATTCAATCGAATCACTCTGAAAGCTTAAACTATACTGCATCTATAGGCACAACACCTGCAAAGTCAAACTTTTACTCGACCCCACTTTAAAATTAAAGCATAAATAATACAAATAACAACTTTTTTTTAACAAACACTTCTTCTTCAATGTAAAATACAAACAATAATATGATAGTTACAAATACAAATACTCCTTAGCAGTTATCAAGTAATACTGTGTAGTAATTAAATAACTCTAATAATCAATTAATATTCACTAAAAACTCACAAAGCAGTAATTAGTTTCAGGAATAGTTGAAGGAAGTCATAGAAATTATTAAAGATACTTAAAATTTTATTTCTGAAAACTAAAAAAGAGTTAGCTTTTAGAGATATTTAGGTCAAGAAATATTTTGGGTTCTTCATAGATGGCTTGAAACTATATTTTAGTAAAACTTTACTCATATATCATCAAATATAGAGCCTTCTGTTTAGAGATTTCTCTAATAAATTAAAGGAGATTTTTTGAATATTAGAACTTTAGTTTAGAAGCTTAAATTTGAATTTAATTCAAAATATGAAGACGAGTTTGAAATAATAAAAAATATTTAAGAAGGTTTATAGAATTTAATTAAAGTAGGTATTGAGGGATTTAATAACGGAATTGTTAAGATAGAAACTAAAACTTCTTTGGATGAGTTCTAAAAATATTTGACACTTCTCAATTTTACAATATTACAATACAGATAAATAGATAGCTAATTCTTTAAGTGTCAAACTGAAATGATGAAATATGGTAAGAATAAGTAACCTTATAAAATTGATTGTCCATATTTCATTATTGACCACACAGTTACTCAATAAGCAACACTTGAAGCTGATGATGTGTATGAAGGACTTAAAGCTTTCTGCCATCAATATCTGAATAAAACTTTGCACAAAGAAATACACCTCAAGAAACTTGAATTTTATCTTGATTTTGATAACACTGGTTAAATTTAGTTAAGTGATGTTGATGACTTCTTTACTTTTGTTTGGTGTAATCCATATGAAAGAGAGTAATTCTTGTCAGAAAAGGAATTCTTTAAATCTGATGAAAAGAAAAACAAATACAAATTAGTCCTAACATTAAAAAAGCAATCACCAAACTTTGATCCTTTATTCCCTAGATAAATTTATATTGATGAATATGGAGTCGTTCCCTAAGACAAGAGATAATCTAAAGACAGAGAAAAAATTCGTAAGCCAGTTAGATTTGGAAGAAAAGCTATGAATAATAATAACCTTATTCCTTGTGACGTCTATTTTGGATAAAAGGAAATGACTATCAGTAAAAGATAGTTTGTAATTAAGTCTGACTAGGATGATTACTATGCTTATTGCATATCTACTACCAATCCTACTGAATTCTTGGTGATGACTGATGGTTGCTTTATCACCAAAGGCTCAGTTATCACTTTATCTGATAAGGTTTGCTTTATAGTAACAGAATGCGTAGTACCTCTTGACGAAGAATAAGTAGTAGAAAAAATGGAAGAAGAGAGTATTATTGGAGATGGACCAACTGTTAGAAGAGGTAAAAAAAATAATCCTGCTCTTGCTTAGATTAAAAGCAAAGCTGACAAAATGAAAGAAATATAAGACCCTAAAGACTACAAAGAAAAGAATATTGCTGATGAGGATGAAGGATTAAAAGTTGAAAATGAAATAACATAAAAAGATGAGCATAAAACTTTTGAAAAGAAGAAAGGAGGTATGAAGGATATTAAAGAGTATTTCTAAAAGAAGATGAACAATGAAAAAATTGATGATGAGCAAGCTTAATTTGTTACTTAAGAATTTAAAAATCAAAAGAAGAAGTAAAAAGATGATGAAGAAGATTACAGATGTTTCCCTAATAAGGATATGACAACGAAATGCACAAGAAGAAAAGGTGAGTGCTATTTATAATTAGAGTTAGACTGGTGTGATTTGGAATGTGAGGATTAAATAAGAGAGACCCTTAAGAAGTTTAATTAAATTTAAAGAGAAAAAAAACAAGGTTATTTTACCATAGGAACAGCTAAAGGATTAGAAATACCTATTGAAGACCATTCTATTAAAGAATTCTAGTGCTATTTTATTTATAAAGAAGAATTTAAAAAATGGATTTGTATGGATTACAACTAAAACATTATGGCTACAGCTATTTAGAAAGACTAGTACACTACCGTTGCATTTAAAGGAAATAATGATAAAAATCACTCTGAATTATTCAAACTACAAAAAGGTGCAGTAATTGTTGTATCTGGAAATTTCCTTGAAGTTGATTTTGTTGATGTTGACTTTGATAAGAATTAATGA