TTHERM_00777060

Length: 2352 bp

cDNA Sequence

ATGAGTTACTAACAAGAAAATTTTCATTTGGTCAGAGGTAAGCTTTTGGCAGTTATGACTGTATAATTTGCAGAGAGCTAGAGCGAAGATATAGAAATATATTAAAATGATGATCCCAGGAAGCTCGCAGAAGAATTTATTCAAAAGAACCAATTTGATGAATCTATTTTAGAAATTATTGTTGAGAATATCAATATTAATAAAAATTTAGCTATGGAGGAATATAACAAAAACCCAGATAACTTTAAAGTATAAAAGGATTCAGATTTCAACAACTGCGATTAAGGCGAAGAACATCAGGCTTAATAAAAACCTAATGAAAAATAGAATGATGCCATTAAAAATATATAAAATGATAGTTTTATTTAGTAAAAACTAATCAATCAGCAAAATAATTATAATATTTAAAATAAAGAAAACTCAGATGATTCTCACAATCATTTCATAGAATCCTTTCAAAATTAAGAAGACTTCAAGGGCGTTAATAATTTATAATAAAAAGAGGATGATGATTATTAAGCATATCAATATAATTTAATGATGACTTAAAAAGCTGAATAGTTTTTATAGTAGAAGAATAGTTTTTAATGGTAGTAAAATGATTTTAAGAAGTAGAAAAGCGATTTTTAGTCGTAGAAGAACTAAGACTTTCAATAAAATAACCAAGTAAGAGTAATTGATAACAATGACTTCTCTAGCTCTCCAGCAAACAAATTACAGCTTATTAGAAATTAATTTAAAAAGAATAAAGTTTCAGATAAAAACCAAAGTACAAGTTAATCTCCAAATACTTCTTTTTAGAAGTAAAAGATGCAGAGTGATAGAGCGTTATTTGAATAAAGCTAGAAAGAAAATACTGCTAAGACATGCTTTAGTTAGAAAGATGATATTTATAACTCACCCTAAATAATAGATGCTAATTTAACTTCAAAGAAAAAGCTTATGACATAATCCAGTCGCTCTAAGTCGCCTAATTATCTTGCTTCAAGTTTAAGCACAAGTGCTTCAATTAAAAATAAAGATGTTGGATATATTGAAAAGATTATTTAAAAAAACTATTAAAATTAATTTTAAAATATCTTTGAATAAAGCAACAATTATAACACAAAATCTACCAGCACTTATAGAATTCTTCATAATACAGAAAATGACCCTAAACCGTTTTAGCCTTAAATTAGTAAAAGAAGCTAATAAATTGCCATGGAAAAGAATAAAGATACATCTCCAGCATTTATAAGACTACATAATTAAAAAATTAAAACTTTCATAATACAAGCAGAGCCTCCTTAAAATGAAAATTTTGAGCAGACAAAACAAAATTTGAACAAAGAAAAAGCTTCAGATAAATCAAACACAACATCTAAAAAGCTAAGCTAATTAGAAATTATGGAAATGAGCGAAAGAATGCACTTATAAGCAAAAAGGCATGAAGACAAACTTAAATAATTAAAGCTATTTTATGAAAAAATGGAAAAAGAGTAGCTGCAATAAGATTTTGGAAAGCTTTACATTGCAAAGAAATCTAAATCACCTTAAAAAAAATCTCATGGAATCATCCAAAAAGAAAAATAAAGTTAAAAAGAAGATAAAAGAACAGCAGATTGGAATTAAATGAAATAAAATGAAAATAATATTTAGCAATTCTACTATAAATCCAGAACACCTGAAAGATTAAAAATTCAATAAAATTTAAATGTTAGGAAAAGCTCTTAAAGTCCTATTCCTTCTAACAAATCAAAAACATAAATATTAACTCCTAAGCAACAAAATAAAATATGTTACAGTCCTAACAAAACAAAATAAAATAATACCTACTAACCTTAGTAGATGTAGATGCTATTAAGTAGTGATAATTTTTACAATAGTAGAAGTCCAAATAAAAATTAAGGCAAAGGGCATGAACACCTAGCTTATAGAAGTGATGATTAAGTTAAGATGTCACACATGACAATCCATACCTTGAAAATAGATAGCCTGAGAAAACAAAAGAGGATAAACGATATTTTTACTGTGCTAGACTCTGATGCAGATGGATTTATTTCATCTAATAAAATTAACGTAACTGCTCTTCCTCCTCCTCTTCTTAAAATAATATCTCCCATTCTATATGAAATGGAGGAATATAATTTCAATCTCAGCTACGAGGACTTTATTGGCTCAATTTAGCTGCTAGAAAAAACATTAAGTGATAAATAACTTGAAATACTTTATTATTAAACTGATGATTCAACCAAATATAAATTCTACAAATAAAAGCAACTAACAAACATAAGTAATTTATCTTATGAATAATTGCAAAAAATTGGAAGGTAAATAGAGTCATGCAAAGGTAATATCCATTTCAAAAACTGA