TTHERM_00780600

Length: 1653 bp

cDNA Sequence

ATGTCAAAGAAATAGCAGGCAGATATTTTGTAGCCTAAAAAAGTAACAAATCTCAAAGATTTAATGAACGTAGGCTATTTTGAGTATGCTTAAAAGGGAGATTCAATATATACTTTAGTGCCATATGTTACAAATAAATAGCTACATAATTATACTAAAATACTCGAAAAAAACAAAGATCCCTAAAATGTTTCTGAGCAAAAATAAAAAATAAAAAACGATATTAAAAGGGAAATAGAAAATTTACGTAAAGAAATTGGAGGATGCTATGATGTCTTAAAGAATCTTGGTTCATTTTAAGTAGTTAAAACAGAAAGATTTGATTTACCTGACAATATTAAAGCAAAAGATGTAATTACATCTATGCTGATTCGTAAGCAAGAAATATCAGTAACTAGGAAGATGTTTTAGGATGGTTTATAATCAATTAGAGAATGTCTAGAATAGCAAGAAAATACAATTAAATAGTAGCAAAAGTATAAGCAGTCATTTTACATATCTTAAAGTTCCTAAGTATCTTCTTATAAGCCTTTCCCTTATAAAAAAATTGATAATTAGATTTATATAAACTTCTACAACATACCTATCTTTAATGATAACCAAATCGCTCCTTTAAATATATCCCCTTATTTACTATTCATCCCTCTTCAATATAAAAATGATTAAATAACTGCTAAGTTAGCTGACGTTTACAGAACAACTCCTGATATATTTGAAAAGCAGTTGATAATAAAGGTTGTTAAAAATAATACTCTAGGTCAAGATCCAGAAAAACTTGGGCCAACAATCTAATAAATATCGTTTTTATTTAAACCTTAATTAAGTGAAGAGGATGGGGATGAAGACGATGAATCTCAGATATAAAAGATATATTAACTAAGATACAGAGTATATGAAAGGGTTATTTTTAACAAGTTAATAAATATTTGTAACAAATTCGTCCCTAAATAATTATATATCTACGACACATCAGTCTATCCAAACTTATCTGTATAATTAATTACTTCTAAATTTTTTTCTTATTAATAAACAATTAAAATACTTTAGATATTTATTGATGACAGCTATACTCTAAAATTTGAGTTGAAAAAGCTGAGCTAGGAAGAAAAACGATTCTATGATAAGAAAAATTCATACATGTCAAGAAAACAACAAGAGGAAAATATAGCAAACTAAATTTCTTATAGCACTACAAGATCTCCTTATACACTAAATTTATATAGTAATTTGTTTAATTATATGACAAAGATGCCATCACATCGCTCATTGATAAAATATATAATTGAAATTAAGATAACAATTGCTTAGAAATTGTTCCTTTATTAACCTAGATTTCAAATAAATGTCATAAGAAACTAAAATGAAGAAGTTGTTTATATTGGTGCTCATATTAATAGAACTTCTTCTAAATCGAATTAGGAATAGCAGTATGATACTTAACTTAAAATTACTCCTTTTACTACAGAATTTTAGCAATTAAATAAATTGAGCTATACTTTTTCAAATTCTTTAAGCGAAATTCCAAGATTCTGCAAAGAAATGTTATTTGTCTCAGATACTGGTATAATATCTCAGAGAAACCAACTCAGAAATTGGGAATTAGCTTAAATGAATCTATAATAATAGATGATGCCAGCATAAACTCCTTAATGA