TTHERM_00782120

Length: 1599 bp

cDNA Sequence

ATGAAAGATTAACTAATTAAATTAATAGAAGAAGAAGACTTTTTAAATTAAGACATTTACACAAATTATCCTTTTTTAAAGTAGGAAAGATAACACTTTAATTAAATTGCTAAATCTATTTGCTTGAAAAACCAAACTTTTTAACCTGACCTAGAAGACACTTTAGCTTAACAAACAAATTAAATAGATACAACATAACTAAGGATTGGTGGTAAATCCGAACAAAATACAGATTCATTTGCTTTAGAAACTATTACAAAATTCATCTGTGAATAATGGGAAAACTCGTTAAAGTAAAAAATAAACTTAAAAGATAATTCTCATTTTTATGGATTGAAGGACAATGTAATTGAATTAGATTAACCATAATTGGAGGATTTTAAAATAATAACTTTTTTGATACCTGGTAATGGAATTGAGAAAAATAATGCTTCAGAAAATTTTGGATTATTAGAAAATTGTATGGACATAGAATCTTAAAAAAACTTATTTGTTTTTTTCAAATGGTAAGAAGATATCAGCATTTTATAAATCGCATCAAAGCTTTTAAAAACATTTGTGCTTGAATACGAAAATAAAAAAAATTATTAAGAGTATTTAGAAAACTTCTTGAACTATTACCTTGGAAAGTTCTGTCTTAATAAACTTAAGAGGATTGTTTACTAGTTAATATAATAATTAAAAATATGCATCAAATTACCAAAGCTTGCTATTTCTATTCTTAGAAATATAATTGACTTATTTGAAAAAGCACTTGATTCAATCATTAAATATTTTTAAGATACCTACTAACGTTCCATTGATTTTGGTATTGCATTAGCAGAATATTTAAACAACTGGAACTTGATAGGAAATTTATAAATAGATTTCTTGGGATATGACTATGGTACTGTAGTTATAGCTTAGGCATTGAAAAGATTGGTAAATCCAGCTAGATATATAATTCTAATGGGAGGAGTTGCAAAAATAACAGATATAGAATAATCATATAAATTGAAACGTTTTAAAAAGTGTTGTAATTTCTATTCTACTAATGATATTTTCGTTGAAACATTCATTTAAAATACAAATCTTTTAGGAGATTAACTTTTAATAGGAGTAAATTCTATATGTGAAGAAAACAAAGACTTTTTTTCTAATTACGACACAGAAATTGGTTGTTCAGGTTATATAAATAAATATAAAGAGCTTTATGATAAGGCTATGACAACATTTAAAAATGGCTCTTCAAATGAAGGATAAAATAAAAAGAGATAATCTAATAACTATTACTCCAAAATCAAATAATTTTATGATGAGTAGAAGACTTATATTTTAGCATTTGCAGTATCTCTGATAATGAAATGTGGATTTGGTTGGAATAAACCGATAATAATAACCAATGAATGTATTTGTGGCTATTTTATTTATGTATGCCAAAATTTTATTTAAACTGAAAACTCAACAGCTCTTAATAGCAATAAATATATGTGTGGCTATTTGATTTATGTATGCCAAAATTTTACTTTAGATTAAAGACCCAACAGCTCTTAATAACTTTAGTTTTTAAAAATTCCATAATAAAATGGAAAAATAATAGTATAAATATAAAAACAATGA