TTHERM_00784600

Length: 3909 bp

cDNA Sequence

ATGAAGAGAGTTCAATCTTAAGAGTAGCTTGGTTAAGGTAATTCACTGACTCAAAATTCTTAAAATTTATTAGGCAGTGCTAAATTAAATATTTATGAAAAAGCAGAAAAAAGAGGAGGAGTTTAAGTGTTTGTTAGGGTAAAACCCACATAAGATGGTGACCAAAGCATATTTTCAGGAGATGATGAAAATGGTAGATCAGTTGTTGCCACTAAAACCCCTCAAAGATCAAGATAAATATAATATAGCTACAAAAATGATAGAAGTTTAGAAAAGTTAAATGAAATATTTTAAGATAAGGCTGATGTTTTCTTTTTTGATAATGTGTTTAGCCAAAAATCCAGATAAATAGTTTCATATCTAAATTTCTATTTTATCAAATAAAGCTAAGAAATCTTCTATCGCAAGACAGCTAAAGAAGCAGTTTCAAACGTTGTTAGTGGATAAAACACTTCCATTTTGATACATGGTCCATCAAGATGCGGAAAAACATATACTCTCACTGGTGCAGATAAACACTAAAAAGGATTGATGTTTAGATGTGTAGATGATCTTTTATCCAAAATAGATGTTGCCAATGAATAGGATTCCTAATACAAATTATTCTTGTCTATTTTCTCAGTATACAATAATGAGATATTTGATCTTCTCAGTAATGAGAATTCTGATTATTATGAAGTAATTGAGTATAGTCCAAATGATGTTAGAATTGCAGGTATGTCAAGACATTTAATCAAATACAAGAGCGAATTTAAGAATAAATACGTGAATGCATTAAAGAAAATATAGTCTCTTAGCTAGCTTTTGAATGAAAAAAAGCTTTATGAAAAAAGTCATATTGTTGTCCAGTTCAATGTTTCTGAAAGTGAATAAATAAATTTCAAACTCAATTTAGTAAGACTTGCAGATATTGATTTAGTAGATAAATAAATAAATGGAGATGATTTTGAGGTTATCGAGCAATACATTAATTAAATCAATTAAAACACTTCATATTAAACTAGAGCTTATAAAAAGTGTAAATTAACTTCATGCATTAGAGATACAATTAATGAAAATACTCAATCTTTCTTTATATCATGCGTTTCTTCATCATCTAATTAGTATGCTTAATCTCTTCTCTCATTAGACTATACATAAAGACTTTGTGCTTAGGGCTCACGCCTTCATGATGGAAATGAAATTAGAAGTAGTTTTACTAGCAATTCTTAAAAAAGACTCCTTCCTAGCAGACCTCCTGTTTCACCAAATTCTGTAAAATCAAGCTTGATTGAAAACACTTTGAGACCTCAGCTCTCTTAATCAAATTTAAGATAAAGCAATATTATTAATCAAAGTAGCACAGCTCCTAAATCAAATATTTAGAATTCTCACATTGAGTTTATTGTTAATGAGTTGGAAAATATTTTTGAGGATATTCGTAAGCAATCACGTGTATTTGGAAGACTACCTGAAAGAGAAAGAAACGAATGGGTTAGCTAAAAAGAAATCATTTTAAACGATCTTTAGAGATAGATTGAGTTACAGCCCTACAGCAGAGATATTCCTTATTGCGAGACTCTTCTAACCAAGTGCTAAAGATAGTTAAGACTTATTAATCCTAGCTTAAGCGATTAAAGATAAATTAGTGGTTCTCCTCCTTAAGGACATGTGAATAATTTAGGGCAAGGAAAGCTAAATGGCTCATAAACAAATTTCTTTTAAGGAAATTTAAATAATAGCTTTTCTAGAGTTAACCAACACAATAGAAGATAAAGTTAAGGAGGATATGCTGAAAAAGTAGGTCGCCTTTCTCCTTCTCAAGAAAACAGATATAATGATTATGAGTTTTTAAAAGATAAAGAAGAAAAATTAGACAAAGACTTCATGCGCCTTCTTGATAGATATAATCACTCTAAGGAGCTGATTGATAGTCTCAGCAATCCTTAAGGATAATAATAGCACTCTCAATTAAATCAACCCTATCCATAGTAATTGTAAAGAGTTTAGACTCAACCTTCTCTAGGATAACGCTCTCCTATTTAAAGTATTATCAGAAACAGCTAAATCCTCTAATCGCCTCAATAGAGATTAGCTGATATAAGCAATGTTCATCAATAACTCTAAAATAATCAAGAAATGTATCGTACTCAAGATTCATCAGGATTTTTAGACCAACCTCCTATCAATAAATCCAAGGTTGCAGTTTCTAGCAATATTGGAGAACTCAGTCCTAATTTTGACTTACTTAATGCAGAAGAAAAAGAGAAAAATGTAGGAAAAAGCTTAAAAAGACTAAAAGAAACAATTGAAATCAAAGAAAATATAGAAAAATCAAAAATATAAAAACTCTAACTACTTAATAAAGACTTAAAACAAAGTTTAAGGGAATATGTCGAAAAATACGAGTAGCTTTCTGATATTCTAAACAGCAAAGATGGTGAAATCGATAGATTGTAGTATGAGCTTAGGTAAGCTTAAGAGGACATTCTTCTTAATGTTGATACAGTTAAAGAATTCAAAATAAAGGAATAAGGATGGCTACAGATGGAAGAGGAGCTCAGAGAATCAAATATACAATTAAAATCGAAGCTACTCAAGAAGAAGAAGAAAGTCAATTAAATAAAGGAGGAATTTAGAAGAAAAGAAGAAGAGCTTGCATTTTAGAAAAAATCACATGACCACGAAATAGAAAAGTACTAAAGAACTGTTTAAGAGCATGAAGAAATCAAGTCAGTAGACCAAAACAAGGCAACTGCTCTTTCAGAAATAGTTAATTAATTAAAAAATGACATGGATTAGAGAGAATAAGAATAAAAACAAGTCTTCTAAAACTTACAGGAAATGAGATAGTTGAACTAAGAGCTCAACTAAAAATATCAAAATGAAGTTATTGAGAAGAATGAAACAGTAAATTAGAATCATGCTTTAACAAGAAAGAAAGAGGAGCTTGAAGAACAAGTGCAAATTCTTGAATAAAAAATTTAAAAGCACAAATAAAAATTTGAAGATGAAAAATCCAAGCTAATGGAGGAGAGAAACTAAGAAAACTTGAAGAAAAAAGAAAAGATAAAGTTTTTAAAAGCTTAATTAGCTGATAACGAGGACAAACACCAAGAAATTGAAGGTAAATACTAGCTTCTAATAAAGCAAGCTGACAACTTGGAAGCCTAGTTAAGAGAAACTTAAAAGTACCTTAATGAATTAAAAGAAATAAAAGACGAATAAACTTATAAGATAGCCAAATTGACTGAAGAGGTAAATATTTAGAAAAAAGAATCTAAATTTATATAAATAAAACCTATAAAGGGTAGGGTAGAAAAATTGGAGGCATCACAGTTGGGAGATGCTAAAACTATCAACGAGGTATAAAAATAAAAGAAATATTAATGTAAAGAATTTAATTTTATTTCTTATATGATTTCTGATCATCAAAAGCTAAAAGAACAAAGCAGCCGTTTGCAATCTGAGCTTAATGAAAAAGAAGATCAATTATAAAAGGCTAACTAACACATTGATTAGTTACAAGAATAGTAAAACATCGAACTTAGCACTTTTGAAATAAGATTAGACCAAGTTGTTCAGGAATTCACAGCCTGCAAGGAAGAAAACAATGAATTTAAGAGAAAGGAAATTGACAACAAGAAACTCCTTCAAAACTTAGAAGAATAAGTTGAAAAGTATAAAGAAAAATACTTAAAGGCTAAACACTCAAATAAAAATCTACAATCTCATTTAAAAGAACTAGAAAATCGTGTAAAAGATTACATGACTGAAAGATCTATAGAAGTTTAAGCCTAAGCTCGTGAACGTGAAAGACAAACTAAAGTTGAATAAACTCAAAAGAATAAATTAAGAATTCTTGATGAAATTTAACAAATGATTAAAAGTCATAAACACAATTCCACAGTATAAAAATATGAAAATTGA