TTHERM_00794310

Length: 279 bp

cDNA Sequence

ATGGTTAGAAAAACTAAGTTCATCGTTTTATTTTTACTATTTGGTTTGGTTTGGAGTTTTGTAGTTTTTAGTGGTTTACTTTCTAAGAACAAGCCTTTAGACACTATAGCAAAAGCTCTTCCTGGATATCTATTGATGGTATTTGGCTGCTACTCATTATATTCAATAGGTTATGACTTATGGATTCTCAAAGAATACCCTGAAGATTACTAGTCATTATTAAAAGAAATTGATGAAGCAAAGGCTTTCTACAAAAAAAATGGTGTTAAAATTGATTGA