TTHERM_00794670

Length: 240 bp

cDNA Sequence

ATGCCTAAGTTTCCTAAAGAAATCGAATACTCTGACACCTATAATGATGATGCATATTTTTATAGAAATGTAAGACTGCCTTAAGACCTATATAAAAAGATTCCTAAAGGAAAAATTATGACTGAGGATGTTTGGAGATCTCTGGGAATTAAAAGTTCAAAGGGATGGCAACATTTTTATGTCTATAAACCAGAACCATTCATTATTATGCTAAGAAAGCCTGTCAATTTCTAGAATTGA