TTHERM_00805850

Length: 354 bp

cDNA Sequence

ATGTTTATCAATATTATTTATTCTATCAATGGGCACTACAAATGCGAAGAATAAAAAGTTAATTATCATAATAGAAGAAAGAAAAAAAGGAAAGAATAAGAATAAAAAAGTAAAAGCAAAAGATATTAGTTAGCTATGGATCCAGTTTTAGGTGACGTTATTGCAACCAGAATCTATAAAGCTTGCTTCAAGCACGTTTATGGCAAGAATATGAAGGCTTATTCTGAAAAGGATGAGGCCAAGTTCGACCAATGCCTCACCAGCTACGTCGAATCTTACAAATCAGTTACCAATCACTTTATCACTTATCTTGGTCAACTCCCTAAGAAGGGTTTATCTCTTGATGGTTCTTGA