TTHERM_00836690

Length: 2337 bp

cDNA Sequence

ATGTTATCCAAAATTACTCAAAACACCTTGAAGTCTCTCTCCGGATAGGCAGATAAAAAATAGAGAAGATGCTAAAAATGGCGTTCATTACAATAAATAGTTGATTAGAATAAACTTGAACGCCATTTGTTTAAGGGTTTCGCTTCTCATTTTTTTCAACCTTAATACTTGATTAATTGTCGCGATTTAAATTAATCTCAAATAAGAAGAAAATTATATATAAACAAACAATTTGCTCAAAGGCTAATTAATATAAATGAAATCAAAAACACTAAATAATCTTTTTTTAAACAAACTTATTAGTGCAAGCAAGCTTTCTCTGTTAGAAAAGCTTTCTACGACTTCATTTACAAGGATGACAAGTCTGCTGAAACCTACAAGGTTACTACTGCTGACCCCAGAACTCCCGTCTAGAAACGCAACTAATTTGGTATAAAGGAAAGAAAGGTCTAACTAATACTTGCAAATAGCATCAATAGTTTTATCGTAGGCACATGCCATAAAACGCCATTCACAAAGGTTCACTTTCTTTTTGGATTAGCTGTAGGAGTTGAAGATATTCAAAAAAGAAAGTTAGGATAGATACCTTTAGTTTTATTTAGATACACTTAACAAATAAATAGCTTAGATATATAGATATACCAAAAATTAAATTTTATAGATACAAATTTGCTTCTAGCAACTGGCAATAGAATAACTGAAAAAATAGATAGCATTTAAATGCACATTTTAATCATTAAATCAGCCTCTGACATTTTCACAAGTCTAGAATTTGTTCAAACAGTAAATTTTAATCTAAAAAAGAATTAGATAGAAACATCATTAAAAAAAGCAACTAGCGAAAATGACTTTGTTTAAAACATTTTAATTTCAAAAATGATTAGGAGAGAAAATAGATAAATAAATATAAAAAGCATTTTAGCAAGCAAGACCAAGCATTTCTTTATCAAATACCAAAGATAGTTTTATGAATTCTCTATAAAAATAATATTAAAAAGTCAAAAATATCTAGCATAATAAACTAAACTGCTTTTAACATATTTATAGGGTTTCAGAGGCCAAACTGCCGAAGACGTTGCTGCCAAGTACGAAGTCACCAAGCTTGCCAACGGTGTCACCATTATCACTGAATCTTAAACTTTCCCTTCTCAAGTTGATATGGGTATTCTTTTGGACGTCGGTACCAGAGATGAAACCAACGAAACTTCTGGTTCTTTACTCTCCATCAAGAACACTTACCTCAAGACTGTCTTGAACACAAACGAAACCATTAACTACGGTGTTGTTCAACAATCTGGTGGTTCTTTCGAAATGGAATATGACTAAGAAACTGCTTACTTCAAGGCTAACTGCCTCGCTCACGATGCTACCGATGTCTTCTCCATGGTTGCTGACTGTGCTCTTGAACCCAGATCTACCGTCGCTGCTTCAGTCGGTGTTGAAAAGAACTAAAATACCCACAAGCTCGAATCTTACCTCAAGACTGGTGAACTTTTCAACGAAAGCGTCTTCAAGACTGCTTATGGTTTGAAGGGCTTAGGTTTACCCCTTAAGGGTTTAAGAGGAAACGTTAAGAACTTGTCTTCTTACACTTTATAAAAGTTCTAATTGGAAAACATCACCCCCAACAGAATCTTCGTCTGCGCTGCTGGTGTTGAATCCCACCAAGAATTCGTTGACCTCGTTCAAACCAAGCTTGCTTAAATCCCCTCTGCTGAAGGTCAAAAGACCCACCAAAGAGAAAAATCCGAATATCTCGGTGGTGAAGTTAGAAACTTAACTGAAGAAAGCAACGTCACCCTTGCTTTATTATTCTAATCTGTTCCTTGGAGCTCTGCTGACATAGTTGCTTTCAACGTTGCTGCTGCCCTTCTCAACAACCTCAGACTCAAGAAGAACCTCTTATAAAAGTACGCTTACTTCGATTAAGCTGAAGCCTTGAACTTCCACTTCACTGACTCTGGTTTATTCGGTCTCAGAACTTCTGGTTCTGCTGATAGAGCTAAGGACATTCTTAACCACAGTATTGCTGAATTGAAGGCTATTGCTTCTGGTGTTAATGCTGATGAACTCCTTACTGCTAAGGCTGCCCTTAAGAACTCTGTTCTTTCTGCTCTCGAAAGACAAACTGACAGACTCGAAGAAACTGTCAAGAATGTCAGAACTTTCAATAAAATTCAACACACTGATTACGTTAAGCAAATTGATTCCGTTACTGCTGATCAAGTCGCCAAGGCTGTTGCTAAGGTTTTGACTTCTAATCCTACCTTCGTTGCCCAAGGTAGTCAAGTTAATGCTCTTCCTACTTATGATGCTATTAGAAACCTCCTCAAGTGA