TTHERM_00846910

Length: 897 bp

cDNA Sequence

ATGTATAGCAAAAGCGTAGTTTAGACTGCATAAAAAAAATCCATTATAGACATATTTAAATCTGAGGATAAAGATTTAAGTAAGAAAAAGTAATTAGAACAAGTAGTCTAAGGAGAAATTTGGGTAGTAAAAAAGTTTTTATCTACTAAATAATGTTAAGAAGTAATTAAATTCTCAGAAAGCTAAGGTTTTTAAGATGCTTTGGTTAATGTTGGATATGGTTTAGGAGTTCTTGATAAAGATTTTAGAGACTGCAATCGCGTTATGATTGACGATGTTGAAACTGCCTAGTATTTGGCAGAAAAACTAAGACCATATGTTCCATTATGTTAAGAAGGAGCATTATACCATGGAATGAATGAGAGATTCAGGATACTAAAGTATAGCAAAGATCAAAAGTTTGCTATGCATTAAGATGGATGTTGGAGTCCTTCGAAATCTATCTTTTCTATTTTGACAATTTAATTTTATTTGAATACAGTGGATAATGGAGGATTTACTCGCTTTGAATGGGAAGGATGGGAATCTAATGAGTATAAATGTAAATCAGAGGAGGGAAAAATAGTTATATTTAGATAGCAAGGATGGTGGCATGAAGGATCTCATGTTTTAAAAGGACTAAAATATACAGTGAGAAACGATTTAATGTTCAAATTATATACTTAGAAAGAGTGGGAACAATAAAAATAACTTCATGATCTAACTTGCGGTGTTTGCTCTAAAAAAGTTAAAGCTGAGGTGTTACAGTGTGGACATTTATTCTTATTTTGTGGTTGCCATGCATTCTATAATGGAGATATTCATACAAACCCTGAAGAAAAAAAACGTCTAAGAAGTTGCTGCTAATGTGTCAAAAAAATATAATCTCCAAGCAAAGAACTTTATGAAATACTCTGA