TTHERM_00848090

Length: 963 bp

cDNA Sequence

ATGGCTGAAGATAGAAAGAAAATTCAAACCCATCGTTTTTACGAATAAAAGTATCCCAAGGAAAATGACTTGGTTGTCGTCGAAGTTGTTAAAGTTGAAGAAAACTGCTGTTATGTTTAACTTTTAGAATACAACAGAATCGAAGGTATGATTACCCCAAACGAAATGACCAAGCAAATGTAGTAAAGTATTTAGAAGGTTTTAAAAATTGGTAAATAAGAAGTTGTCCAAGTTCTTAGAGTTGATGAAGAAAAAGGTTATATTGATTTAAGTAAGAAGAAAGTTAGAAACAATCAAGATAATGCCTGTTTAGATAGATTCTCTAAGGCTAAGGATATCCATTCAATTTTGATTACTGTCTGCGAATCTCTCCCTTAAGATTGCAGTGTTAAAATTGATGATTTATATACTAAGATTGTTTGGCCTTTATACAAGTTATTCAACCACGCTTATGATGCCTTCAGATTCGCTCTTAACGATGAAACCATCATCACCAAGATTGACATTGCTGCTGAAGTTAAAGAAAAGTTGCTCTAAGTTATTAGAAGACGTTTGAACACTCAACCTATGAGAATCAAGGCTGACTTTGAATTAAGATGCCACGAATACGAAGGTATTGATGCTATTAAGGCTGCTTTACTCGCTGGTGAAGCCAAATCAAGAAATAAATGCGATGTTAAATTTGAAATCATTGGTTCTCCCGTCTATGCTGGTTGCATCGTCACTCAAGACAAAAATTTAGGTATTGAAGTTCTCAACGAAGCTTTGAAGGCTGTTGAAGAAGTTATTATCTCTAAAAAGGGTTCTTACAAGCTTAGAACTGAGCCTAAAATTTATGGTGATAAAGCTCAAGATAACTTAGAAATGTTGGAAAAGGCTGAAGAAGAAGACGAAGATGATGAAGATTCTGAAGTCGAAGGTATGGGTGATGACGATGAAGAAGATGAAGAAAACGATAACTGA