TTHERM_00859230

Length: 1764 bp

cDNA Sequence

ATGGGAGTGAAAGAAGAACAAAGAATGTAAATTAGTTGCTTTTCAGCCCAATCTGATCAAATAGATTGCTTTAAAATTAGATAGATAGATAGATTAATTGATGAAGGTAGAATTGAAAAAGATATATCTCAAGAAATGTACTTACTTACATCTATGAATGAGACAGACGAGATTCTAATTAAAGCAGTTGGTTTTATGCTGAATCGATAAAGATTTCTTTAAAAGCTCGGTTTCTAAGCTCCAGAAGCTGTTTAAAAATAGATAGACGAGTAGCAAAGATAACAAAATGAATAGTTAAAAAAGCAAATTGAAGAGAATTAAAAGTAGTAATTGAGAGAAAGCATCAATAAAAGTGTCACATCATCTCGAATCGAAGAGTAAAAGGAGTAGCCAAAAACAGCATCTTCAACATAAGGTGAATCCTTTTCATCTTAGAGGGGCAAGCAAGACACAGAAATTCTTGCTCCCTATTAATAGAAACCCCTTCCTTTTGACGAAGAGATTTCAAAATATTTTGATCATCCTGTAATCATGCATGAGGAGAAGGAAGAAAGCACAGCTGATGATGACGACGATGATCGTGTCAACGATTTATAAACTGAGCCTTAGATGTAACACACTGTGAGTATAAAAAAACCTCGTTTATAACTCTCGTAGAGCTTTCTTAACAGGGACGGTGATTTCCTTATAAATTACTATATAAAAGATGATAACTAAAAAATAAGAAACAAGTACATTAATAAGCTCATTTCAAATAAAATTTTGCGCTAAGAGCCTTCAAAAAAGCACCAAACCAGCAATCTTTAAATGACAAATTCTTAAAAGAATATTCAGTTAATTTAAAGATTTTAACAAGATAAGTCAATCGTTTCATATGCGAAGAATAAATAAATCAGAATACAGTCTTGGTTTTCAAAAAACAAACAAACAAACTCATAAACAGTTTTTATGCTTGCTTATTAACACAAATGTTTTAAATATAAAAAAGTGATTATTTTTGATTGGGACGATACTCTTTTCTGCACAAGCCAGTTGCATGCTTAGCGCTTCGAGAACATTACTTCAGATTAGCAAAAGTAGCTTTTGAACTTAGATAAATCAGCAAGTATGGTTCTAAAGGAAGCTTGTCACTACGGAGAGACATATATTATTACTAACGCTGCTCAAGGTTGGGTTGAGTACAGCAGCAAGAATTTTTTGCCTACTGTCTATAAATATTTAGATGAATATAAAATAAAAGTTATATCTGCTCGTTCTTTATACGAAAGCCAATACCCAAATTAATGCCATCAGTGGAAAGTTGAAGCATTCAGAGATATTAAAATAAACTTCGATAAACAGCAAACTAAAATGATTAGTGACGTGATTTAGGTTCATGCAAACAAAAATATAAACAAGCACACACAAGTCTTGATAGATTAAGATCAAAAATAATTTTTCAACTGTTTTTAAATAAGAGAAAATAGCTTAAACAATTTTGAGTAGCTAATAAATAGCTAAGAAAGTAGCAATTATCTAAGAATAATTTAAATCAATATCTTTGTGATTATTAACATCATCAACCACTCTCTTAGCTCTAAATAAAGCCAAATCTTTTCTTTTACTTACTTAATGCACTCCCTCGTTCTTTCTTAATCATCTACGATATCAATCAAGCGCTCTCTAAATTTAAATATTTTAATAAATATTATCATACATACCCAAAAATAAATAAATATCTTCCCTCATCTATCTTAGACTTTTATAGCATACCAAATTAAATGA