TTHERM_00865050

Length: 2583 bp

cDNA Sequence

ATGAACACAAGAAATACATAAAGGTCAATAGATCCAAAAAAAGGAAAGTAGCAATAAAAATCAGTTAGCAAAAGTAGAAGCAAAAGCAATAATATAACTTAAAGCAATGAAAAGATAAAAAGGAGTTAAAGATTAAAGTCAAAAGATGAGATGATAGATTCGGTTTAAGAACCCAATATTTTCGTCTAGAAAGATAAAAATAAACAATAATAATCTAAAAGTAAATCTAAGAATTCAACAAAAGAATCAGAAAAAAAGCCTTAAAAAAGAGCATTTAAAATTGAGATACCTAAATAAAATGAATAAAAATTAAAAAAAACTTAAGAATCAAATAAAACAATAATAAATTTGACTAAATAGTAGAAATAACAATTAAAATCATAATAGCTAACAAAAGCTGTAATTGAGTAATAAATACACACTGAATCAAAGAAAAGGGAATACAATAAGCAAAAGAATAAAAATGATAATTTAGAAAAAACTAAAAATAATCATAATATTGTTACTATTGATTCCAGCAATGATGAAAATGAAAGTGAATATGAAATTTCAGATTGTCATATTTCAGTTTCTGTATATAATAATGATAATGAAATAGATATAGATAAAAATGAATAGTCTGTAGATGTAAAGTAAAATAAAAATAAAAATATGATAGATAGTAGAGGAAGAAGTAAAAATAGCCTTAAAATTAAAAAAACATATTCTTCTAGCTAGTAAAAGAGTTAAGAAAAATAGTAAGTTAAAGAATCAACTGCCAGCAAAAGGATTACTCGTAGCCAATAAAATTTTGAACTTACAGAGTTATAAGATACAAAGGCAAAAAGTGCTTCAAAAAACAAAACAATAAATTCGGAAAAGCAAAATTAAAAAATGAATTCTAAAGAAAAAATTGATACAAGCAAAGACAAGAATCCATCATTAATTGAAAGTGAAAAACCTAAAAGAGGAAGAAAGCCTAAATAAGTAGAGATATTAAATGATAAAATTTAAGAAAAAGAGACAGATTAGTAAAAAACACCTAAAAAGAGGGGGAGAAAAAGTAAATAAGAAGCATTGTTAGATAGAAGAAACATTAAGGAGATATAATAATAAAAAGAGTACGAAGAGAAATAATAAAAGAAATCTTCATCTAAAGAATCTTAAAAATTAACTCAAGCCAGCGAACATTTTAACTTTTAAGCGCTAATTTATTAATAAAAACCCGCCAAAAAAGAGTTACGTATTGAAGACAAGAATTATTAAAAAATAAATGTTAAACCAAAACATAATATTTATGATTAAGCTATAGAAATGCTATAAGAATATTCATTGCCAGAAGAAATTCCTTGTAGAGAAGATGAAAAGAAATAAATTTTAGAATTTATAAATGAAGGTTTAGGCAATAATGGTAGCTCTAATTGCTTGTATATTTCAGGTGTTCCTGGTATAGGAAAGACAGCAAGTTTTTTGGAAGTGATTAAAAAATTATAAAATGAAAAAAAAGATGAATTTACTTTCATTCACATTAATGCTATGAATTTAAGTAACCCAGAAAATTTATACTATATACTCGTTAAAACAATAACTGGGAAAAATTGCACATCAAAATAAAAAGCCTGTTAAATTTTAAATGAGCTTTTCACTCGTGGAAAACTTTCAAAAACATACTAAAGCTATGGAGAAAATATTGATAATAAAAATAAGTAATTTTTGACTAAAAAATAATAAAACTATATTTAAAATACTATTTTAATTAAATTCAGGGTGATTCTCTTAGATGAATTAGATTATTTAGTCACATAAGATTAGGATTTACTTTATAACTTAATGGAATGGCCTCATCATAAATACTCAAAATTAACTATTATTGGGATAGCTAATACTATGAATTTACCAGAAATTTTGATGAACAAAATTAAAAGTAGAATGGGAAGTAGAAGACTTGTTTTTAATTAGTATAATCATAAATAAATACAGGAAATTATTGCTACTAGACTTAAAAATTAGGAAAAAGTTAGGGAAGTGTTTGAGTAAAATGCAATAGAATATACATGCAGAAAAATTGCTATTTCATCTTCAGATATAAGAAAAACATTGAAAGTGTTAAGAAAAGCTGTTGAAATATGTCAGTTAGAAAACTTTTAAAATTAAAATGTTACAAAAGTAACTATTCCTATGATTTAAAAATCGTATAGCTAGTTATACTCTTCTCCTATTCTATATTCAATTTAAAAACTTTAATTTCATCATAAGTTGATGATTCTTTCTATAGCTTTAGAAAATAAGCACAGAGGAATACCAGTAGCTTACTTGTCAGAGAGCTATAATAGATATAGAATAATGTTGAGCAATCTAGGTAAAAACGAAACTATTAATTATAATCAAATGAAAATGGTCCTGAACTAACTTTCTGTTTTAAATTTAATACAATTGAAGGAAAAAGAAATAGTTAAAGATACACAATTAATTGGTTTAGATCCTAATAAGAAACACTTTTGTCATGTTGTTGACATTTAAATTAATTCTAATTTTAGTGTTGATGATGTCACTAACTCTCTAAAAGAAGATGAAATTTATTTGAAATTCTAACATTAATTCTGA