TTHERM_00865250

Length: 357 bp

cDNA Sequence

ATGAACTCTTAAACAATCAGAGCTGCTCATATTTTATAAAAGCATAGAGGAAGTCGTAATCCACTTGATAGAGTTAGAAATGTCCAAGTTACTAGAACTTTAGATGAAGCTAAAAAAAATGTAGCAGCTTTCCGTGAATAGATCATGAAATCAGCTGATCCTTAAAAAACTTTTATGGAAATTGCACAAAAGTATTCTGAATGCACATCTGCTAGAAATGGAGGTGACTTGGGAGAGTTTGGTCCTGGTTAAATGCAAGAATCATTTGAATAGGCTGCATATGCTCTTAAAGTCGGAGAGATTTCTAACTTAGTTGAGTCAGACTCTGGTGTTCACATTATTTTAAGATTAGATTGA