TTHERM_00874740

Length: 2964 bp

cDNA Sequence

ATGATGAAAAACAAATTAATTGTTTTAGCTTTACTTGCTATCTTCAGTTACTAAGTTTGCTGCTAAATACATGTTGAAACTTTGCATGAATTCAATAAATGGTCTGCAAAACACAATAAAGTATTTGATCCTGAATAGCTTAAATATAGGTTATCTATTTTCGCTGAAAATTATAAAAAAATCAAGGAGCACAACTATAACTCTTCCAATACCTTTTAACTTGGACTAAATGAATATGCTCATATGACTTCCTAAGAATTTGCTGAAGTCTTTCTTACTCCTTCAATTTCTAAAAGCTAATAAAAATAACCCAAACCAAAACCTTAGCCTTAACCACACCCTAACAATAGCACTAATACTACTGTAACAATTACTCCTATTGATTGGAGAAATAAAGGAGCTGTAACTAGTGTGAAGAGATAAGGTAAATGTGGTTCATGCTGGAGTTTCTCTGCTGCAGGTCTTATGGAAGCATTTTAATACTTTAAGACTGGTAATTTGATTGATCTTTCTGAATAATAGCTTGTTGATTGTGACAATTCATCTTTTGATAAATCCTACTACTCTAATGGATGTAATGGAGGTTATCCATAGGAAGCCGTTGAATATGCATCTAAATATGGTATTGTTCCATTAACTGATTATCCATATGTTAAATAATAATAACCATGTGCAATAAAATCACCAACAACTAACGGTTACTACCCAAAAGGTGTTAAATTTTTAGATCGTTCAGCCCATGGTATCTTGTAAGGTTTAAAAAGCTCTCCTGTCTCTGTCTTAGTAGATGCAAGTAATTGGCATTTATATTAATCAGGAATTTTTAATAATTGCTAAAATCTTATTAACCACGCTGTTTTGGCTATCGGAAACGATGAATAAGGAAATTACATCATTAAAAACTCATGGGGTACAACCTGGGGTGTAAATGGATACATGATTCTTTAAGCTGGTGAAACTTGTGCTGTTGACTATCTACCAATCACAACTAGTGTTAAATTAGAATAAATGAGCAATATTATAAAAGTATTTGACATATTTTCAATGCCTTTTGCATTCAATTTAAAGGAAAAGGAATATAAAAGAAAGACATTAGTTGGAGGCATTATTTCTTTAGTTATTATTTCGATATCAGCTATTTATTTTGGCTACTTATGCTATCTTTATTTTAATAATTACATTAATCCAACTATTAATGAAACCTACCAAACAATTGATTACGACTTTTCTATGCCTATAAGTAATAATTAAATGGCTTTTTAAATCTTTATGTCAAATGGCTAGACCCTCGATTAATACTAGCAAACAGCTGGTGTGACTTATGCAATTCCTTTGGTAAATTATGTGTTTCCTGATTTTAATAATAACTCATAGTTAAAATAAACTCCTTTAAATATTATCAAATGCTCAGATGTTTCCTTAAATGGATTTTATTGCTTTGATTTTACTCCTATAAGTAACAATTAGAATCAAATGAATATAGGTTTTGATAAAAATTAAATTGGAAACTACAGATTTGAAATTAGCATCGCTTTATGTAACACTTAGCAGTTTATTTCTACTTATAATTGTGCAAATACTGCATAAATTTAAAGCGATTTTTTAAAAATAACAAATAAACTAACGCTAAAATTGACCACATAGAAATACAACACACAAACATAGCTTTATTAACAATTTACTAAAAAGGAACAAATATCAATCCAAGATACTTTAACAAATATTTTAAAAATTAATTTTTTAAAAACAAATTCTACCATCTAGTAGGGTTTTATTACTTAAAATAATCAATATCAAAATTATATATCTGATTATAATAAAGAAAATCTATACTTTACCTAATCTGCAGTTTAGTAGCAAAACAAAAACAATTTGAATTTGGTATCAATAATACAAATTTAAATTGGCAGCTATGAGTTAAAATAGAATATTCAATACCCATAATTCACATACATTCTTGCTTAATTTATGAGTGCATTTAATGTTATACTTGTTCTTGGAATTATTGCCTAAATTTCAGCTCAAAGCGAAATTATTTAAGACTTTGCAGAAATTTAATTTAAGTTTAACTTTAAGCACAATGCATGGAAATATTTAATATCTAAAAATGAGGGCAATATTTAGATAAATATTTAAATTTAAGCTTCTTTAAAAGGAGTTACTAAAAATCCATAAGAAAAGGTATTCTAAAAATTAATAGAGCAAGCTTCATAGCAGTTTAGTATTGTTGATCTTTAAAAAGAGTTAATGTAAATGAAAATAATTTTAAAATTACTTCTCTCACCTGAATAATATGCAGCTATTCAATTATGTGGTTACTTATTTAAAAATGAAAATCAAGATTTCAATCATGATTAATCAAATTAAAGATTAACAAACAATGAAAAGTAAAATTAATGTAATCATTTGAAACAAGACATAAAATAACAACAATAATAATAAGACAAGATAGTAAAAGAGTTACTAAGTTAGGAAGATATCAAAAATGAGCTGGTTAAACTGAAAGCTATTTAATAGCCGTAAGTTTAATTCGAGAATAAAGAAAAATAAGATTAAAAATCTTTATCAAAATAAGAAAATGGGTTTATATCAAACTAAATTATATAAGAAGACATTTTAAATGAAAGAAAAGAAATTAATTAAATAGAAAGTAATAAACTTTCTTTAAAGCTGCAAGATAAAGTTTATAAGAATAGTATCATTTATAAATAGAAGCAGGAATCACAAATCACTGATGATTATAATATCAATATCGATGATAATAAAATTGAATAGAGAAGTGAAAGTAGAATTGATAATCACTTAGAAATTATTGAATAGATAAATAATAATATGGAATAATTCTAAATATTCATCGAAAAGTTTTTAGATCAAAGAAACACAAAATCTGAAATAGATAAGAGAATTTTAAGTTGTATGGCAGGTATCCATAACTAAATTATAAATAAGCACCAATTGTTTTGA