TTHERM_00881320

Length: 1050 bp

cDNA Sequence

ATGAATAGATTTATTCTTTTGAGTATTATCATGCTCATGCCTCTCTGTTTGGCTCAAAATGTAAGTGTAGAAAAACTTCTTGCTTATAATAAATGGTCAAGCGAACATCAAAGAGTTTATCTGAATGAACATGAAAAATTATTTAGACAAATGGTTTTCTTTGAGAACTTGTAAAAGATTTAGGATCATAACAGTAATCCTAATAACACCTATTCTATTCATTTAAACTAATTCTCAGATATGACTAAACAAGAATTTGCTGAAAAAATTCTTATGAAATAGAGTTTTGTTGAAAATTTTATGAAAGGAGCCAGTTAATAGGATAATAATACTAATGCTAACCATAATGAGGCTAATCATAATGATGCTAATCATAATGATGCTAATCATGAAATGTAATTGAATTCAAAGAACTTTACTATAGCTACTTCAATAGACTGGAGATCAAGAGGTGCTGTAACATAGGTTAAGTGGCAAGGTAATTGTGGTGCATGCTGGGCTTTCTCTGCAACTGGTGTAATGGAGTCATTTAATTTCATTTAAAACAAAGCTTTAGTTGAATTTTCTGAGTAATAACTCTTAGATTGTGTCATTCCTGCAAATGGTTACCCCTCTTCAGGATGCCATGGTGGATGGCCTGTTTAATGCATAGATTATGCCTCCAAAGTAGGTATCTTAAATCAAGACAGATATTACTATTTTGGAGTTTAGATGTAGTGTAGAGTGACTGGCACAAATAATGGTTTTAAGCCTAAAAGCTGGGTTTAAATTCCTAACAATTCAGATGCCTTAAAAACTGCTTTGAATTTCTCCCCAGTTTCTGTAGCTGTAGATGGTACCAATTGGACTGATTATAAGTCTGGAGTTTTTAACGGATGTGATTCTCATGTTAGTCTTAATCACGCTGTATTAGTAGTAGGCTATGATGAACAAGGTAACTGGATTATTAAAAATTCTTGGAGCACTCTTTGGGGTGAAGGTGGATATATGAGACTTGCTCCTAACAACTCATACGGTATCTTAAACTTAGGTTATTAAATCACTTCTTGA