TTHERM_00895780

Length: 5529 bp

cDNA Sequence

ATGGAATAGTATGCAGATAGTCTTTAGACTTTTAAGACTATTTTAGGAGAAGCGTTTACAGATATCCTTAAACATTTACCTAAAAAGTATAAAGATTTTAGAGAGCTAGTCTAAAAAACATAAGAGGAAGTCATGAATGAAAAAGATAAAAAAGCAATCAATGGTAACAAGTACTTTATTATATTTAGCATGGCAATAGGCAGTCATATTCCTCGTTTGTGTTAATCATGCATTCATTACATAGAAAAATTGATAGCATATAGATTTATGGACGGAAACTGCTATGATTATACTTAGGATAAACTATCAATAGATGGCGAGAAAAAAGCTCAAATCGATCCAAACAGAAAGTTAATTGATCAAATTATTGATTCAATATGCGATTGTGTCAATTTAAAAGATGAAAATGTTCATCTGCAAATAATTCGTTCACTGCTAACTATTGCAACAAGCTCTATTTGTTAAGTTCATGGCTAAAACTTAGAGAAAATAATGAGAACTTTGATTGTCATTCATTGCACATCCAAGCAGCCATAAATTTAGGATCCTTCTAAGCACTCATTTACACAAATAATATTAGAAACCTTTAAAAGAATGGAGAAGAATACTCTTCTTTCTTAAGAAGAGACTCAAATTTACCAAAACAAAAAGCAAATAGGTCCTGTGTTTAATCCAAATTCAAGCTCAAGTTATAGAAGCTAAGGAAACTCTAGCAACATTCTGTTGAGTGCCGATTAAAGCGTTTATTTGATGTAAAATCATGAAGGATAGCAATAATAACAACAATAGTAAAACTCTGTACAGATAGATCCTCTTACTTCAAATAATGAATTAATGAATTAAATGGTGATTTAAATAGATGAAGATTAACAAAAGTAAATTATATCTAACTATGTCTCTAAAGTAGTTACCAATTTGGTAGATGATGTCTGCATTTATGAAGATAAAATTAAGAAAATTCAAAGAAAATACATGAACTAACCAGAAAATGAAGTCCAAAAATAAGCTGAAATTAATTTGATTCCTCGTAAGTCAGTTCCTAACATGCAAGATGTAGATACTCCTCAATACAAAAAAACTACAATTGCAAGCATTAAAAATGAAAAAGAAATAGATGCAGGCAAGTTTGGCTGGTGCTTTGTATGTAGAAATGAAGCTTCCAACTTCTGCAAAGATACAAGAGTTCCTATTTGCTCTAAAGAATGCAAAAAGTAACATATGGAGGAAGTAGCTAGAATCGCTAGACTTTGTTTCAAGGGTTAAGAAGTAGCAGTAAATCAATACATTATCGATGCCCTCACAGTTTTTTAATTTTTATGTAAACTTTCTCAAGAAGACCCTAATAATAATTTGAATGCTAACCAATTGAGATAAAAAGTAATAATTTTAGAGCTTATTTTAAAAGTCATGGACTAAGCTGGATCTGTCTTCCTTTCAAGAAAAGAATTCGTTTAAGCTGTCTAGGATAAGTTAGTTCCTTCTTTGCTTTAAAATTGTTTGAGCACAGAAAAATCTGTTTATGGACTTAGTTTCAGCATTGTTGCTAATTTAATTGACAACTTCAGAGAAAATTTAAAAACTGAAATTTCTGTCTTCATAGAAAACATCTTTGTAAAAATATTAGAAAGTACAAACAGTAACTTTTTCAACAGAGTGTACTGCTTGAAAGTCTTTAATAAAATATTTTCAATTCCTAGAGCAGTGATTGAAATGTTTGTAAACTACGATTGCTCAATGAATTAAAATAACACTATTGAACAATTGATAACTTTGCTCACAAAAATTTCTCAGGGAAAGTATTAGAAAGCTGAATTTTAGAATTTAATTCAACCTGAGTAGGCTTAAGAGTTAAAAAATCTATCTTTAGAATGTATTGTATAATTAATGTAGAGCATAAATGATTTTGTAATGATTTGCGATGCTCAAGAAAATCAAGTTGTTTCCAAGAGTGAATTGCCAAGTAAGGAAGAGTAGAACTTATAAACAGAAAACGAAAACAATATTTCCAAAGTAAATAACCAAGATGAAATCAAAGATCCTATTGAAAGAGAAAGATAAATGAAGCTAGAGTTCTAAAAAGGTATTTCTAAATTCAACTTCAAGCCAAAAGTTGGTATAAGACACTTCATATAGCATGGTTTGATTGAAGAAGGAAATCCTAAACATTTAGCAGAATTATTCTTTAAATTTAATAACTAAATTAATCATGAAAAAATTGGTGAAATATTTGGATCTCATGAGGAAAACAACAAGAGAATTCTTGCTGAGTTTATTGAATATCTCAATTTTGAAAATTTAGACCTTGTTAATTCTTTAAGGAAATATCTGACTTACTTCTAACTTCCTGGAGAAGGTGAATAAGTTGATAGAATCTTAGAAAAATTTGGTGAAAAATACTCCTTAGATAACCCAGAATGCTACAAAAATGCAACAACTTCTTACACTCTTTCATATGCTCTTATGATGCTCCACACCTCATCTCACAGCGCACAAGTTTAAGAAAAAGAAAGAATGACTTTGCCCTAATTCATTAAGCTCGTTAAAGGTATTGATGATGGTAATGATTTGCCAGAGTAAATGGTTGTTAATATGTATAATGATGTGAAGAAAAACCCTTTAGGTATTCATCATTTAGAGGCTTCTAAAAAGGCATTCGAAGATGCTTTGACTTCAAGCGTAAGCAGAAAGCATGAAATGTTTTTAAAGGAAACTGAACAAATGTTTGAAAAGGGATAAATGAAAATATAAAGAAAAGAAAACGAGAAATATATTCAAATAGTATGGAGCCCTGTCTTTGCAACTATAAGCTAGGCAACCATGATTGAATAAGAAAAAGAAAGAGAAAATCTTGATTTAATTGCCAAAGTTCTCACTGGGTTTAAAAATAGCATTAAATTACTGGGCTAGTTTGGTATGCTAACTGAAAGAGAGACTTTCGTTTTTGAGTTATGCAGATTAACAGGCTTACTGACTCCTCAAAAGCTAATCCGCCAAAAGAATGTGCAAGCTATTAAAATTATGTTAGAAATATGCACTCAATGCCGTAATTATTTAGGAAGATCTTGGAAGATATTACTTGAATGTGTTAGCAAGCTTGACAATTACTACTTGATTGCATAAAATTTGAGAAGAGACATTGATTTATTAAACAATGACACTTACTTCCAAGATAATAACAACATGCATCAAGATGAAATCGACAAGTATAATAGCTAGGTTATTATGAAATACATTGACATGTCTGAGATCGATAAGATATTCCATCTGTCAAATTAATTTGATGCTGAAACTATTGTTGAATTCATTAGATGCTTATGTGAGTTGAGTAAGGAAGAGCTAGAAAACATTCATAATCCAAGAATTTTCTGTATTTAGAGAATCGGTGAAGTTACAGAATTCAACATGTCAAGAGTGCGTATCATTTGGAATAAAATATGGGATATTCTAAAGGTACATTACAACAATGTTGGTTGCCACAATAATATAAGAGTCAGCTGTTTGGCTATAGACTCATTGAAGTAGTTAGCTGTTAAATTTTTAGAAAAAACTGAACTCGCTCATTATTAATTCTAAAAAGATTTTCTTTCACCTTTTGAATACATTTACTAGAGAAATCCATAATAAAATCTAGAAATTAAAGAACTTATCTTGAGATGCCTTTTCATGATGACAATGAGTAAGGCTTAATATTTAAGATCAGGATGGAAAGTTATTTTGAGAGTTGTCAATTTAACTTTGTAAGAAGATAGTCAGATATTATTAGATTTAGCTATTTAGATTACTGATTTGATTATGAATCAAAAGAATCTTGATAATACTTTAGATGTGTTTGGCGATTTGATTCATGCTCTTACTAATTAAACTAAATACAAAAATGACATGATAGCTTTAAAGGCTTTAGATCATTTGAAGAAATGCATACAATACTTAGTTGAAAACACTCAATAAGAAAAGGATAAGGATTAAGAGTAAAAATAACACAATAAAAATATTACTGCGATGGAAGCCAGTATGACTTCTGAAGCAATTGCTGAAGACGACACAAGTAGTAGACACTCTAAAAACACGAAGCAAAATATCATTATCAATGAATCAAAGAGACTGCTTGAAGGATATTCAATTCCCATCTTAAGCAATTTTGCAAGCTTCTTCAATGACGATAGACCAAAAATGATCATTAAAAGTGTAACTTATCTCTTCGACTCCATTAAGCAATACAGCTACACATTTAATCAAGAATTCTGGAATCTTATTTTCAAAGGAGTATTAAGACCTCTTTTTGATGATATGCAATTTACCTTTTAAAAAAATAAATCTGGCTAGACCGATATCATCAAAGCTACTAAAAATGCTTGTTAGAAAGCTTTCACAGAGCTAGTGAACATTTTCGTATAATAATTTGATACTTTGCATCCTTGCCTCACAGACTTCATAGCTATTATGAATAACAGCATTTCTACAAATTAAGAAATTATTTCTTCGATAAGTTTAAGCAGTTTGAAGACTTTCTTAAGCAGAATAGGTTAGAAATTAAATGAAAATGAATGGAATCTAATTATTGAATCACTATAAGGCCTAGCTTTAAATTGCAAGCCTATAGAAATGCTTGAAGCAAAAAATGCAAGTGAGGACTTCAATGTTCCAATTTAACAATTGCTTAGCAAACCTATTTATAAAGATACAAAATATGATGTGAACATAGATTGCTAAAAGAATATTATCTAATGCGTAATCTTTAAAAATATGGTTGAACTCATTCTCAACATAATTGAAGAGTTTACAAATAATTTAAATGAAAAATAAATCGATAGCTTGACATATATCCTTAAAGATTTCTCTGAATTTTGCGATGAGTTCAACTCTCGTCTTTATCTCAGATTCTACTTATGGAAAAGCGGCTTAAATAGTAAAAATGAAGCAATTCCCGTCCTAGGTAAATAAGAAAAACTATCTAAAGGAGGTGTATTATTAGTGCTTTATGAGAGATATAAAAGAACTTAATCATTAGAATCATTAGATATTTTCCTCGGTGAGACAGAAAATTACTTGAGACAGCTAGAAAATGTTTTGAATGAGATTAAATAGAATAATGAATAATAAATTTTAAAATAACAGTAGTAATAATTATAATAGTAATCATAATCATAATCATAAAATTCAATCAAAAACTCTAAGCAGGGGTTCTCTGAGAATAACACTCCTTAGATGAGTGAAAGAGGACAATAGAATTAAGTTATTTAGAATGTAAACACTATGCACCTAAATGACAAATTATTGAGCTATGCTTACGAGGATAAAGAAAGATAACTCAAGGCTCTTAGATTCATTGTTGGTTCTTACATATTGCCTAATCTTCATGACATAGACCCAAAGGAAATTGGAGAAAGATTGAGGAAAATAGTTAATTTATTATTAGAGGTCAGCAACTAAGATGCAGACATTGATGACGACTTTAATTATAATTTAAAAATAATCCTAAAAAAATACTTTAACTTTGTTTTTGATTTGGCTTCTTCAACTAAAAGATGA