TTHERM_00898290

Length: 2532 bp

cDNA Sequence

ATGTCGATGCAAATACCATCTTCTAGCAGATTGAATTTTACCCATGATTAAATGGAATACATCAAGTAGATATTTTGTAAAGAGTTTGGTGAAGATACAACTGAATACTAGATGCGTAAAAAACATCTAGATTAGAACCCTGGATCCATTTTTATAGATGAGCAATTTCCTCCTGATAGAGAATCCCTTTGCAACAATTGGGACGATATTACAGACTAAGCTACTTTAAAGTCTTGGTCACAAATTACATGGCTTAGACCAAAAGATTTTTTGAAACTTGCTCCAGGAGAATAGATAAAATTATTTGACACTATTGAACCAAACGATATTAAATAAGGTATTTTAGGTGATTGCTATTTTTTATCATCATTAAGCTCTCTAGCAGAAAGAGAAATGCTTATTAAGAGATTATTTGAAACTAAGACTTACCAAGAAAATGGTCTTTATGCAATCTGGTTAAATATTGAAGGAGAATGGAGATGCATCGTCGTCGATGATCACATTCCTTGTAAAAATAAATAACCTGCATTCACTAGATCTAATGGAAATGAATTGTGGGTACTTTTATTGGAAAAAGCATACGCAAAAGCCTATGGTTCCTATTACAAAATTGAAGGTGGTAATCCAGCAGTTGCTCTCAGAGATTTAACAGGTGCCCCATATGTCAATTTTGATGAAAAAGAACCAGATAGCATGTTTAATTTCTTATTTGAGCATGATAAGTCAGGAAGAGGTGATATACTTACATGCTACACACCTTCCACTGAAATTAGAGAAGCTCAGTTAGATGTTGGTCTTTATTCAGGACATGCTTACTCAATATTAGATGTCCAAAAAATTAAGACACAAGATGGCAAAGAACATCGCATCCTTCAAATTAGAAATCCATGGGGTAAAGGTGAATGGAAAGGAGATTGGGCAGATAATGATGAAAAATTGTGGAATAAATACACAATGAGCCAAGTTCCTAGTTTCAAAAGAGAAGAAGATGGTTCATTTTGGATGAGTATTTAAGATTTTTGCAAGTACTTTGAAGGTGTTGGTGCATGCTAAATTTAGGAATCAGCAAAATATAACTCTATTTCATTCAAATTAGCTTAAAGCAATTAGGCAATTATAAAACTTTAGGTTTTGAAGAAATCCAAGCATTTAACTGTTTCTCTTAACCAAAAAGATATGCGTCATTACAATAATGATGAATCAAAATATAAATATTCTTTTGCAACTTTCATCCTAGTTAAAAGAGAGTAGAATGGATCTATTAAATGGATAGGAGGGGAATTCGATGTTGAAAGAAATATTGCAATTAGATAATACAATTTAGATGAGGGTGAATATTACATTCTAACCGAAGTCATGTGGTGTTAAAATCATTATAGAAACTTAATAGTTAGTTGTTATGCTGAGCAAGAAACAAAGTTTTCTTTGATTCAAGAGGGTATGGACTTCGACAAGTTTATGTGTTAAGCAATTAAATCATATTGCACAGAAAACGTAAAGTTTTCCGTTGGAAACCCAAACTCAAAGATAAAAATCAATAAATATAATGGCGATTAAATTGGTAGAATTTATGGCTCTGACATGGGTCTTCTTTTCTTCTACTTCTACAATTTCTCATGGAACACCAGTTTATACTAAAAGCTTTCTTTCACAAAATTGCTAGGGTATTCTCTTCCTAAAGAATATTAAGGTATTTTTTTATTACAAAAATAAGTGACTAAGAAAATGTTAGTTAATACTTTATTTTTTAATAAATTAGATAAAGATAACATAGAAATAGCGATTCCACCACAAAAAGAGCAAGTGCTTGTTTTGAAATTTAGTGCCACACAAGACTACAGAACTGAATATAGCTTTAAATCCAGTATGTAAATGATGAATAAGGAATAATGCCCTATAAATCCCAATCCATCTGTTTTCCTTACCGAAATATGGTAAAACGAAATTAAAGAAGAGAAAAACACTGCTGCTAAAGATAGAAAATTGCAATCAACTAACTTCAGTCTTGGTTATCAAACTGTTGATAACACCTCATCAGTTTCAGTCATGAAGTTTGAAATCAATCTCATTAATTCTCTAGCTGCCTTAGTAGCTCCATTTGTAAATGATTGGGCTAGTAACATATTTAGAATTACTCTACTATACATATTCTACCTCCTTATATTTAGCTATGATACTTGCAATTTCTTAGACATGGTCTTAATTATGAGCTGCTATATACTCTTCTATTGCCAAGTTATGACCAGAAAAAGACTTAGAAGATTTACTTTACTCTTTTTAGTTTCTATAACGCTTTCAGTTGTTTGGTTTATCATCTATCCATCCAAATGGAACTCAGTTGATGCTTAATTTGATATGATAGGTAAAGCCATGACTTACTTTATCCCGATCATGTAGCTAGTCTTCATTTTCCTTAAATCTTATGTATGCCTGTTTTATTGGAAACTTTTTGTCAATTACGATGAGCTAATTCATGATGTTTACAATCGCTTTAATTTGGATCTAAAGAAAGAAATTATTAGCAGAGTTTGA