TTHERM_00900600

Length: 1488 bp

cDNA Sequence

ATGAATACAATCAGCTAAAATCTTGTAGGATACGAAGAAGCTAAATATAAGCTTGCATAGCATCTTCAAAACAGGAAAAAAATCAAAGAAATGTACAAAATGAAGGGTCTAGAAATGCTCGATAAGCCTGAGTTAGTCTTTTCTGATATATAAGAACCTAAGTTAAAGCCTTATTAAGCTTCAATCTATTAGATTATGAAAAGCGAATTAACTAAAAAAGGCTACTCTGATTTTAGGTATTTAGGACAGGGATCATCAGGATTAGTTTTGTTAGCAAAAGATTCGAAAACCAACATGAGGTATGCCATCAAAGGTGTTTAAGTTAGAGATCCTCACGGAAATTTTGACTAAGATATTTACATTCAAGTGAAACGAGAAATAGAAATACTCAAAACATGTAGAGACTCTCCTTACGTAATCAGTCTTTTAGATTAATTTGAGGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGGAACTCTCACCTAAATTATAGAAAGGAACAAAAACAAAAGACTGAATGAAATATCAGCAATCAAATACGCTAGTGATATTGCTCAAGGTCTCTACTACATTCACTCTAAGAGTTGCCTTTTAAATGATCTGAAAGCGGATAATATCTTAATTGACTATCATGGAAATGCAGTTCTTTGTGATTTTGGTACAGCAGATAACCAAATAAACATATCTGGCTATTCTATCAATCAATATATGGGAAACATCTTGTATCAAGCACCAGAGAGCTTAGACCCAGCTGAACCATTCATAGGTAAGGTTTATCATGATGAATATTTAAAATTAGGTGTTAGTGTGAGACAAGAGCCAAGCTAGAGAGGAATAGATTTTAATTTAATATCAAATAAGCACAAACCATTAAATTATGATGCTGAATTTAAAAATTTTGTTTATCACAAATAACTTAAATATATTATTGATGGATTAACTAATTTTGTTCCAAAAAATAGAATGACTATTAAGGAGGCTTTAATTATTTTAAAAGGAATTATTTCTATTGAATTTTAGTTAGATGACATGCTTATTGAGACGATAGATGGAAACACTCAGCAGTTTGCAAGTTCACTCAAAAATGAAATTGAGTTTGTTAAAGATTTGTCAAATAAGTTTTACCCTATCATTAAAAACTAGCAGACGTTATAGTAAGAGTTAAAAGAAGACCATCAAAAAAGATAATATGAGGCAAAAATATAAGAATTTTTGAAAATAAATCTCTAACTATAATAAAGAATTAATGAATAAGAAAAAACAATTAAAGATTTATTAAGCCAATTGAATTAATTTTAGAATTAGTTTATGAATGAAAATTAGATTATGATGATGCCAACAATGAAAACGAATAACAAGTAACATTTTTATTTTTAAGAAATTAAAAAATAGGAAAAGAAAGATGAATTGCTAAAAGAAAAAAACTAATTTTAAATTCAAAAAATAAGTTTTTAATAGAAACCAATAAAATTATTATGA