TTHERM_00919690

Length: 5361 bp

cDNA Sequence

ATGGAGTAAAATTTGATAACTTAGAGAGATTTGAACCCTCTTTTATAATTCTATCAAAATTCTTATGAATTTTAAATTTCTTAAAGTTAGTAAGCAAGGCGGGATTAATTAAATCTTTAAATCAGAAGAAAGAAGATAAGAAGCAAAGTAAAAATAGATTTAACAAGAATATTAATAAATAAATCTAGATTATACTAACTTAGACAAAAATAAGTGATGGAAACAATAGCTGAAGTTTTCAATGAAGTTTAGGAGTCTACCTCAGTCTCTTAAAAGCAAGTATATGCACTTCTTGAGTAGTATGAAACAAATAAAGCAGTATTTCTTAAAGCAACAGAGCAATGCTATCTTAAAATTATCAAGAGCTTGCTTAAGGCACCAAGAAAATTAATTGAGAAATATGAAAAATTGACTGAAAAATTATTTGAAACAGGATATCGTTAGTACGCTCTCAAAGAAGATTAGTCATCAAAAAAATAAAAGTTAACAAAAAGGGATATCTTTTAACTTTTTTAACATTTCTTGGCATTTTTTGCTGGAGCTCTTGACTCCACTTAACTCTAAATAAGAATCTTCTCTTCTCGTATAATTTTCTAACTCTTAAAGATATTACCTTCAGACACTCTTGTAGATATTATTGAAGTAAAAGTTGCTAAGTAATTAATATTAGGTACTCTTTCTTTGATGAAAGAGAAGAAGGGTAACTTAAAGCACATAGGTATTAAGATTACGTCTTATTTGCAAAAATTAATGGATAGAGATGATCTTACAGAAACATAAGAAGCAAAAATTCTTAGAAGCGAAATGATGAAGAGTATGTGCATGGACGACTAAGACTAGATTAGAAAATTGGCATTAATCAACTTGGAAATGAATGAAAGCACCTTCCCCCATTTAATTAAGAGAATCAGAGATAAAAATCCTGAAATTAGAGCTACAGTCTTCAAGAAACTTATTAAAGAATAAATACCTCTTGCTAACTTAAATTTATCTGATATTTATAAACTTATTTATGATGGTTTAGGATCTAGAGAATCATCTGTCCGTGAAGCATGTATAAGATATCTTTAGCTCAACTATAATTTGTTTAAGGAAGATGAAGAAAATCCTTAAAAAAATTAAATTGAAGAAGAAATGGAATTAGAAGAGAACAAAGAAAAAGATGGAGAAAAAGAAGAAAGCTCTGAAGATAATGAAATTGATGAAGAAAAAACTAAAAAAAAGCAAAGTAAATCTGCAATTAAGAGATTTTTCACACCAAATAAAGAGACTGCCATGAAAGATTTGAAAATTAAAATTTTAAACTTTTTAAAAACCTTTGAAATTGAAAAGAGTCTTTACTACCCTGAATTATACGAGAGTTTAGAATTATTAGTAAAGGAAACTATCAAATAAATATTAGATGCTGATAGCTTCTCAGCATACTTAAAGGATTGCTTTTTAAATCAACTTAGTCTTAAAAAGAAGAAAAAGCACACTTAAATTTCAATCGAAGGAGAAGAGCTATTCCTAATTAGAGTCCTCTGTTAAATGGTTTAAAATCAAGATGATAGAAAGGAACTCAGTCCTGAATTAGTAGCTGTAGTGGAAGATTGCTTCCCAAACGGTGTTGATTTCTCTTAAGTGATTGACTACTATTCATTCACTTAGCCTAATTTATTTTCCCTCTATTAGGTTCTCCTTTTGGCAGAACTTCTCATTAATTGTGATGAATCAGGAAGAAATAAAATTGAAGAAACTCTAAAAAATTTAGTTATTAACATGAGTAATACCAATTTAATATCCGAAATCCCAACTGATCCTTCTAATGAATACAATGATATTTTCTATTACCTTGAACCAGATACTGTTATGAATAATATTTTTTCTCAATCATATTTCTTCTCTCCTATCATTACATGCTCGTATGAATTACTTCCAATTATAGTTCGTATTTTAAAGAAGATTGTGAGTGATGGTAGAGTGAATGTTCAACTTATCTAGCTTATTTCTGAAGTTCATGAGCCTCTAGCTAAAGACACAGATAATGACTCACATTTTGATTTACCTTCAGAATTGGAAAGAATAAGAAATAGTATTAATGAAGAGAAAAAGAAACTCGATAATATTGAAAAAGAATTGTCGAATCTCAAAAAAAATAAGACAAAATAAAACGAAATTTATCAATTAGAGAAGGAAAAAGATGAAAAATAAGCACATCTTAAAATTTGGGAAGAAAAGGAAGATGCTATTTAGTCAAAAATTTTTGATATTTCTATGAGAGAGCTTGTATTAGTTTAATCTCTACTCACTTATTGCAAAGTTGATCCTAAAGATCCTGCTATTTCAAATTTATTGTAGCAAATCATTTTACCTGGATTACATTCTTCTGATAGAAGTTTAAACTTCAATTCCTTGAAATCACTTGCTCTCTATGTTTTGATTGATAAAAAGAATTGCATTGATTTCTTCTCTGTATTCAGCGATATTTTGGACAAGAGTGAAAACTGCTAGAATTGTACTCCACAAGAAATCATTTCATTGAGAAGCATAGTAGATTTCCTACTTCTATATGATCTCACTTAAAAGCAATCCCAAGATGACGAAGATATTGACATTCCTCAAACATAAGATTTAATACTTAAGTATGCTTATTAAGCTGATATTCTTCTTAGAACTATTTCAATTGAAGGGTTAAGCAAATTGCTATTTAACGGAAAACTTCAAGACCCACACACTACTATTTGCTTACTTTTGGTTATTTGGTTTGATACTAAAATCTGCACAAAATAAGGCTTTAAGGCTATTCAGATACTTTCAACTTTATTTAAGACTTTCACTGCCTCGAACTATTACAATCTTCAAATATTTGAAAAAGCTTTGGAATTATTCTCGTAGTTGATGGTTACACTTGAGAAGAAAGGATTAGTTTTTAATGATGAATATGTTATTTTTGATCATAGCAATGAAAAGTTTATTTCAAAGGCTCTTAGAGTTGGAATTAACTTAATGTCCTATGAATATCATAATAACACTGAAGTGCTTAAAAACGTTTCTTCTAATGAATTTCTTCCATAAGAAAGATTCTTCCTTTTCTTGGCATACAAATGCTCAAAAGAAAGACGCTTCCAATCTCTTTTTGAAAAAATTACTTAGTACTTTGACTTTTACAATAAGTGCACTACTGAGTAACTATAAATAATTCTTCACTTCTTAAAAGAAGCTATCGAAAATTGCCCAGTTAGTAAACAGTTCAATTAATTGGAAAAAGTAATTAAAGACAAAATAAAGATTCAAGATAAAAATGAAAGATAAGAAGAAGATGAAGAAAAAGAAGAATTAAATAAAGTTTTAGGTAAAGAAAAGAGTGATAAAGAAGAAGCAAATGATGCAGAAAATGGTGAAAATGGCTTAAAGAATGATGAAGATTAAAAGCTTTATACTTTAAATGCAAAACAATTAAAGATTTGTGATAAAATTATTGAACTATTTGAAGGTAACCAACAAGATATTGAAGTTATTGTCAAAAATCTCTTTTCAAATGGAACGTTGATTAATGACTCTGCTGAGCAAAAGAAGAAAAGAGCTATGATGTATGATGAAGAAGATGAAGAAAGAGCAAATAATGAAGAAGATGATGATAATGAAAAAGAAGAAAAGCCTAAACGTGGTAGACCTGCTAAAAGAAAATCTATCCACCCTAACTCAGACGATGAGGAAGAAGGAGAAGATGATGATGAATAGGAAGAAGGTGCCTAAGAAGAAACAAAAAGAAGAGGCAGACCTAAAAAAGATATCTCTGAAGCTTCTCATGCTCCATCATAGAGAGGTAGAAAGAAAAAAGCTATCTATATTGATTAGGAAGAAGAAGAAGATAATGAAGAGGAAGAAGAATAAGAAAATAAAGATTCTAAGAAAAACTCTGCAACTAGGAAAGCAAAGAATGCTAAAGAATTAGAAGATATACTCAATTAAGAGACAGAAGAAGATGAAGATGATGAAGATAGAGAAGAAGTAATAAATAAAAGAACATCATCTAGAAGAGCTTAAAAAACAGTTTTACCAGAATCTAATGTTGCTCAAAAGACTAGCAAAAGAGGAAGAAAGAAAAAAGATGTGTAAGATGAAGTTATTGAATAAGATGAAGAAGACGATGAATAAGAAGAAGAAGACATGTCAGCAGAATAAGACATTGAAGAAGAAGATAAAAAGAATAAAAAATAAGTTGGAAGAAGAGGTAGAAAACCAGCTTCTACTAAATCTATGGGTTCATCAAGTGAAAAAGAGAGTCCAAAAACTAACAGGAGAGGTAGAAGATCAGCATCAAAAGAGAATAAAATATCTGAAGAAAGTGATGAGGAACATAAAGAAACAGACAACGAAGATTAAGAAGAGGAATTGTCTTAAAAGAAAACAAGAGGCAGGGGCCGTCCTAAAAAATCAAATGAAAAGACTTAATCATAGGAAGAAGAAGAAGGATAGGATAATTCATAATCTGATGAATAAGAAGAAGAGGTGGAGGAAGAAGAAGCCCCTAGAAAAACAAGAGGAAGCTCAAAAAAAAGTACACCAGCTTAAAAAAAATCAAAAACAAGATCTTCTTAGAAATCCGTTGATAATGAAGAGAGTGGTGAAGATGAGGAGCAAGAGGAGTAAAAACCTTAAAAGAAAGGAAGAGGAAGACCTAAAGCTTAACCTAAAGAACCTGAATCAGAATAAGATGAGCAAAACGAAAGTGAGCAAGAATAAGAAAATGAAAGTGAATAAGAGGAAGAAGAGGACGATAAGCAGACAAAAAGAAGGGGAAGAAAACCAAAAAATGTTACTCAAGCAGTGAAAAGAACAACTAGACACAATAGTGCTAATAAAAATTCTGATAAAGAAGAGTCTGAAGGAGAAGAAGAAAATGAAGAAGAAGAGTAAGAGGAAGATGAAGAAGAGTAAACTAGGGTTACTCGTAAGAGGGGTAGAAAACAAGCTGATACAAAGAAGCCTACCAAGAATGAATCTGTAAGAAGCACAAGAAGAGGAGGTTCTAGAAATAAAATGGAGGAAGAACATGAAGATGAGGAAGAGAACGAGTCTTCTGAACAAGAGCATGAAGAGTAAGAAGAAGAGGAGGAAGAGTAAGAGTAGACTAAGACTAGAGGAAGACCTAAAAAATCACCAGCAAACAAAAGTCAAGCAAAAGAAACTAGGGGAAGAGGTAGAAAAAAAAATGAAAAATAATAGAGTGACTCATAAAGTGAAGATGAAGGAGAAGAGGAAGAAGATGAAGAAGATCAATAAGCAAACTAAAGAACAACTAGAAGATAAAAATAATAAATAGAAACCTCGAAAAAACCAGTGAGCTCCTCCTAAAGACTTAGAAGAAGAAAATGA