TTHERM_00926990

Length: 459 bp

cDNA Sequence

ATGGCTGACTAAAAGCACGATTAAGTTGTTGACCAAGTCCACAAGAAGCTCAAGCCCAATGAGTTGATCACCACCGTTAATACTGATAAGGCACCCAAAGCAGTTGGTCCTTACACCTAAGGAAAGATAGTTGCTGCCGGAGCTAGATTATTCTACGCTTCTGGTCAAATTGCTATTAACCCTGAAACTAACACTTTTGATGAGACCTCCTGCGTTGTTTCTCAAACTGAATAGGTTTTGAAAAACTTAACTGCCGTTTTACACGAAGCTGGTACTGATTTGGAATACGTTGTTAAGGTCAACATCTTCTTGGATGATATGGATAATTTTGCTAAAGTTAATGAAGTTTATGGCAAGTATTTCACTGGTGATAACAAACCAGCTAGAGCATGTGTTGCTGTCAAGACTCTCCCTAAGAATGCTAAGGTTGAAATCGAATGTGTTGCTGTTGTCCCATGA