TTHERM_00941580

Length: 615 bp

cDNA Sequence

ATGAGCCAAAAAATTTTACTAATTACAGGAGACTTTGGAGAGGATTACGAAGTTATGGTTCCCTTTTAAGTTCTTCATGCTATAGGATATACTGTGCATACTGTTTGCCCTAATAAAAAGGCAGGAGACTATGTTACTTGTGTTGTAGAAGAAGGTGGTGAAATAGAAAAGTTTTAAACTTATACTGAAAAAATAGGCCATAGATTCTTTTTAAATTATGATTTTGATCAAGTAAAACCAGAAGAATATTATGCTTTAGTTTTAGCTGGTGGAAGGGCTCCTGAATATTTGAAATACGACCCTAGCGTTTTAAAATTAGTTAAACATTTCACAGATAGCAAAAAGTCCATCTTAGTAATATGCCATGGCTATCAAATTCTATGTGCTCTTTAGGGTTGTATTGAAGGAATTGTGTTGGGAGGTCCAACTCCTACTTCATATGAGATTACTAATGCTGGAGGAATATATTAGTAAATAAAAATGGAGGATGCTCTTCTTTATAATAACTTTATTTCCACTCCTGCATACACAGGCTTTTTGAAGTGTTTTCCACCTTTTATTGAATAACTTAAAAACGGTGTTAAATTTGACAACAAAGTTCACATTTTTAAATGA