TTHERM_00942660

Length: 945 bp

cDNA Sequence

ATGGACAATATTCCTCTCATTCCTAACAATCAAATTACTTTGTAAGTAACTATTAAAAATTTGTTATTAATCTGTGTAGCTGTTGTCGTTATTTATTCTTCAAATTAATTAATAAATATTGGCTATTTACCCTTTCTCCAAGCAGTTATCATAGCATTATTATCTTGCACATTGGTATTTAGCATATCCTCGTTATTCTTCCTTCATAATTATAAAAAATATCCTAATTATTTTAATACTTCCAATATCCTTACAATAACCTCTTTAAGTGGTGCTTTTATATTAACCGTGTCTAGTCTCGTCACTTCTATTTCGTACACTTGTGGACGAGAGCTTAGCGGAAAAGATATTGTAGACAATATCTCAAATTGGTAATGTGGTTCTAGTGGTGATTGCGATATTGGTGAAGCATATTATTATGCAGCTAAATATGTCTATGGTCTTTGTTATTAAAGATTAAGTTGCTATACAGACAGTTTAGCAGTATATAAACGTGGTTACGCACTTGCACCCTAGTTAGTTGGATGCATTGGAGCAGGATTACTTTTATTGATGTACCTTTTCACATTTATATAAAATAGAAGAAAACTAAATGAATTATAAATGATGCCTTTAAATTCTAATCAAGATGACTTAAATTAATAATTTAGAAACAATCCTTTACCATATTAAGTATAAGATAGAAGCAATACCAATGCTAATCCATAATATCATCAAAATTATTAATAAAACCCAAATGACTAATAGCAATAAATCAAAAAATAATAATATTAATAATAATAATAATAATAAGTGCTTTGGTAGCCAAATACTTAATAAAGTGCTCCTTAAGCTAACTATTAAGGTAACTCATATAATAACAATTAAAATGTACCTTAAGTAAATTATTAAGAATAAAACAAATAGGCAGTTAGCTAATAATAACAACAACCATAAAATATTTGA