TTHERM_00942680

Length: 138 bp

cDNA Sequence

ATGTTAAATACCAATGTACAAGATGAAAATGTTATGATAGCCACTTGGAGATAGGGTAAATAGCCAATATTTATAAATTAATCTGAAGAATAAAAAGTGGTAGCAACTATGAAGAGTAATAGCAAACTGTAAAAATGA