TTHERM_00947500

Length: 945 bp

cDNA Sequence

ATGGACTACAAAAATAAAAGCTACTTCTAAGTACCTGGTGAAGCAGATAGGAAAAATGCAATTGGATCATTAGCAGGAGTTCCTATTAAAATAAAAAAAGCAATTTAGGCAATTTAAAATGAATTTCAAAAAATAGACGCACCTTAATAGGGAGATTGGCTTTGGGACCATGAAGAACTTGGATAGCCTTATGAATAATATGTATCGACTTTTGAAAAGAGAATTTTTAATAAGGAAAACTCCAATACAATTTATATCCAACCGCTTGAATAAAATATGGGATTTAACAAAGATTTAAAAAAATTTTGTAAGGCTTTTTTTAAAGACTGCAGAGTGAAAGTTAGATAGCCAATAATCATACAGGATATCCCGGCTGTATAGAGAAGAATAAATGAATATACATAAAAGCTGTAACTAAACACAAAGGATATTTTAAATTACTTAAAGACAAGACTACCAAAAGATGCAGTCTGTATGATTGGTATAACAAATACAGATCTATACCCAAAAGATGAATGGAATTTTGTATTTGGTCAGGCTTCGCTTATTCATGGAGTAGGCGTATTTTCATTTGCTAGGTATTTATATAAAAGCAATGATATTCTATCAAACACTTTAGAAGATTAAGATACAATCATTTATAGGGCTTGTAAAATTATGGTTCATGAGATATCACACATGTTTGGATTAAGACATTGTATATATTTTAAGTGTGTAATGAACGGGTGCAATCACTAAGAGGAAAGTTATAAATCTCCTTTAGAGTTATGTGTAATTTGCTTAAGAAAACTTCAAAATAATATTGGTTTCTCAATCATAGAGAGATATGAAGATTTAATTGAGTTTTCTTAAGACAGACCATATTTTTCAGAAATCGATGTGCCTATCTATGAGAAATTGAAAAATTTAATAAAGACTGCCTACGGTCCACATTACTAAAAATGA