TTHERM_00954200

Length: 1398 bp

cDNA Sequence

ATGAGCTAAAAGCAAGTAGCATCTGTCATCGTTTTTGGCGATATTGGTAGATCACCAAGAATGAAAAATCATTCAACATAATTGGCTTAAGCTGGTTATGAAGTTTATTTTGTAGGTTAATTAGAAAATTAGGTGCATAAAGTAATTAGAGACAATCCAAATATAAAAATTATTGACATATCTTCAAATCTCGTCAACAAACTTAAAAAATTACCAAGATTCTTATATTTGCTTTATGCTGCTCTTAGAATTATAATTTAAATATTTTAGCTCTTTTACATCTATCTTTTCAAAATGCCTAAACCTGAATTTGTTATAATACAAAATCCTCCTTCAATTCCTGTACTTTCTTCGTTGGCCATAATTTGTTTCATGAGAAGAATCAAAATGATTGTAGATTTTCATAATTATGGATATACTATTTTAGCATTAGGTTTGAAACAAAAAATTATTTTAAAACTGGCTACATTCTATGAAAAATATTTTGCTAAAAAATGTGATTTCGCCTTTTGCGTTTCTGATGCTATGAAAGCCGATTTGAAAAAAAATTGGAATATAGAAGCAACTACCCTTTATGATAAAGCTAATACTGAGTTATTTGGGCCCATCTCTCTTCAGGAATCCCATAAGCTATTCCTTGAACTTGGTTTAAGCATTAATTAAAAAGAAACACTTTTCACTGAAGAAGTGAATGGAAAAATAATAAAAAAGTAGTAAAGACCTCTACTTTTAGTTAGCAGTACTTCTTGGACTAAAGATGAAGATTTCAGTATTTTATTAGATGCTATGCAATCATATGAAACTGAAAAAGAAGTAAATAAGCAAAACTCTTTGTATCCAAAGCTACACCTTCTTATCACAGGAAAAGGACCAGAAAAAGAAAGATACGAACAAATAATTGAAGAAAGGAAGAAAAGTTGGAAAAATATATAAATATAAACAGTTTGGCTAAAAGCAGAAGACTACCCTAAATTGTTGGCTAGTGCAGATGTAGGAATATGTCTTCACTACTCTTCATCTGGTCTTGATCTACCGATGAAAGTAGTAGATATGCTTGGATCTAACTTACCTGTTTTTGCAATAAATTACTAGTGGGTTACTCAACTTGTTTTTGGTAAATTTATTAATAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAAACAACATATATACATATTGATTTCTCATAAAATCTCATTCGTTTTTTTGTTGATTTTTAATACTAGAAATACTTCAAAATGCATCCAGAAAATGAATTAACATTTGAAAACTTGAGAAAAAGTGCTTCTAAATTTAGAGAGAGTACTTGGGAAAAAGAATGGCAATAAAAAGTGTTACCTATTTTAAATTAGATTAAACAATCTAAAATTAATAAAAAAAAATAATGA