TTHERM_00954210

Length: 1545 bp

cDNA Sequence

ATGTCATTATAGGAATACACATAGGATTTAAATAATCTTTGCAATAAATTAATTTAAGTATAAGATTTAAAGTTATTTGTTGAGAAATACGGTGTTAAAGGAATAGTAGGAGCAGGTTATTTAGCTATAAATAATAAAGATACATACATTAAATCTGAAAGAGTGATTAAGTAATGGATTAAAGATGAAAATCTTTATGAGAAATTTTTATTTAGCACTGATAAAGATGACTAAGAAGTAGTCAAATAGATGCTCTTCCATTAATAAACTCATGTAAGAACTCTTGTTTCTGAGTGCATAGAATTTCATGCATATGATATTGGCTTATTTTTAGAAAGAAATTAATAAAATGAACTCTATCAATCTTACTTGCTAGTTCTTATCCATTTATTAGCTGATTAAGAAACAGAAGTCGCCTTAAAGATTTTGAGAGCGCTCAAAAAAATGACCAAAATGGAAAACAATGTTTAATTTATGGAAGATGATTTCTGGCTTTAGAAGGTTGAAGAAGGCGTTCAAGCAGCAGATGAAGTTGTTGCTTTAAGATTTATGGAACTTATTGTTGCAATGTCAAATACAAATGAAAGAATACACAATAAATTAGTTAACAAAGGTTTGCTAGAAAAATCTATACAATTATATCAAACTGATGATTTGCTTGTGAAGTTAAATGCAGTAGAAATATTTTCTTATTTCGGAGAGAAAGATTACAATTCAAAATATCTTGCTGAACATAAAATTACCTAATAAATTATTGCAGAGGCCTTCAATTAAAAAGAAGAATTGTATATTAGAAAATACTCTATGTTGCTTGTTGCTAAAATGATAGCAAGTTCTGTTATGAAATTGACTCCATAATTAGCTAAAGATACTCTAGCTTTTATTCAACAGCTTATCCAATCTAAATTATAAGAAGAAATATCATCTGCATTTGAAATTATGTCCTTCATTTGCATCAAATAAGAAGGAGTAAATTTAATTGTAAAAGATAAGATTGTCCTTAAAACTCTTTTGGACTATACTTCAAGCACTAAAGTCGAATTAAGAAAAAAATGTGTGAATGTATTTAGTCATATTCTATTTACAAATAGTTCAACCCCAAAAAACAAAAATACTGTGTTTAATTTATTGATGTGTTTTGGTAACTCCTAAATGGCAAATTAAATAATAAATTTTGAAAATTAATATGAAAACCTAGATTAGTTGTAAAATAGCTTTAAAGTTATAGAATAAAATCTGTTTTCTCCTTTCGAAGATATAGAGCTAGATTACATGCTTTTACTTAAACATTGCTTCTTATATGAAGAAATATGCTTCTAGTATATACAAACACCTAAAAGTATAGAATACATGACATCTCATCTCTGCAAAAATAAACTAATCTTTGATTTGAAAAGAGAATTAAGAGATACTCTCATCGCCGTTTGTAAGAAGAACTCTAAAAATAACAAACTCTATGAAGTATTTATTGATAACTATTATAAAGCCTTACAAAATAAATCCAATCCTTCTCAAGAAATGCAATACGAATCTTCTACTTTATGA