TTHERM_00957580

Length: 597 bp

cDNA Sequence

ATGTGTTTCGGATCCAGCTCTAAGAAATAGTAAAGCAAACCCAAGCTTTTAAAGCCCAAGCAAAGTTAGTACAAAACTAAGCTCATTCTTTTAGGTGACATGAACGTAGGCAAAACTTCAATCTGCGAGTATTACAAGAAGAACGTGCCTGCAAAGAACTTGCCAAATACAATTGGTGTCACATATTTCGAGTTCGACATCAAACTAGAAAATGGCATTAACGTTCACTTAGATATTTGGGATACAGCAGGATAAGAAATTTATTAGTCACTACTAAAGATATACTATCAAGATGCTAACATAGTTTTTTTAGTTTTTGATGTGAGTGCAAGATAGACTCTTGAACGTGTTGAGTACTGGATTAGCGAACTCAAAGAGCAAGTAGATGATAAAAACCTAAAGTTGGTGTTAATAGGTAACAAATGCGACATAGATGCAGATAAGAGGTAAATCAGTCTTGAGCAAGGTCAAGATTTTGCTAGAAATAAAAACATTCCTTACTTTGAAACTAGTGCAATCACTGGAGAAGGAATAGTTGAAGTATTCCGCTAAACAGTAAAGGACTATGTGTAATATAAGACAAACGGAGGAAAATGA