TTHERM_00958790

Length: 1449 bp

cDNA Sequence

ATGGATATAATCAGCTAAAATCTTCTAGGAACCTAAGAAGCTAAATATAAGCTTGCTTTGCATCTTCAAAATAGGAAAAAAGTCAAAGAGATGTACAGAATGAAAGGTGTATAAATGCTCGATAAGCCTGAGTTAGTCATTTCTGATATCTAAGAACCTAATATAAAGCCTTAATAAGCTTTAATTTATTAGACTATGAAAAGCGAATTAACTAAAAAAGGCTACTCCGATTTTAGATTTTTAGGACAGGGAGTATAGGGATTAGTTTTATTAGCAAAAGATTCCAAAACTAAAATGAGGTATGCCATCAAAGGTGTTTAAGTTAGAGATCCTCAAGGAAAACTTGACGAAGATCTTAACAATCAAGTGAAGCAAGAAGTAGAAATACTCAAAAAATGTAGAGACTCTCCTTATGTAGTCAGTCTTATAGATTAATTTGAAGGATAACAATTTAGTTACTTAGTTCTAACTGAGTGTTAAGAAAGGAACTAAAACAAAAGACTGAATGAAATATCAGCAATCAAGTATGCTAATGACATTGCTCAAGGTCTCTACTACATTCACTCGAAGAACTGCCTTGTTAATGATCTGAAAATGGATAATATCTTAATTGACTATCATGGAAATGCTGTTGTTTCTGATTTTGGTTTGGCAGATAACATAATAAATAAATCTGGCTATACTAACAACCAATATATGGGAAACTTGTTATATCAAGCACCAGAGTGTTGTGACCCATCTGATCCATACATAGGTAAGGTTTATCATGATGAATATTTAAAATTAGGCATCACTGTGAGACAAGAGCCAAGCAACAGAGGAATAAATTTCAATTTAGCATCAAATAAGCACAAACAATTAAATTTTAATGATGAATTTAAAAATTTTGTTTATCACAAATAGCTTAAATATATTATTGAAGGATTAACTAATTTTGTTCCAAGGAATAGAATGCCTATTAAGGAGGCTTTAATTATTTTAAAGGGAATTATTTCTTTTGAATTTTAGTTAGATGACATGCTTATTGAAATGATAGATGGAAACACTCAGCAATTCACAAGTTCACTCAAAAATGAAATTGAGTTTGTTAGAGATTTGTCAAATAAGTTTTACCCAATTATGTATATTTGTGTATTCTAATCTACCTCTTTTGTTAAATTTTTTAAAGTAAAAATGAACAGACCTTAAACTTAGAGTTAATAGAAGATCATCAAAAAAGACAATATAATAATCTTAGAATTAGTTAATGAATCAACCTTAAATTATGATGATGCCAACTATGAAAATGAAGGAATAATTGTAATCAATCGTCCTTTCCTAAAAAAATACTAAATTTACTTATATGATAAAAATAGCATAATGATTTTTGATGAGAAAATAAATGCTGAATTAACTAACTTTCATATTCAAAATAGCAGGGAGTAATTAATATTTTAGAATGATTTTTGA