TTHERM_00962060

Length: 1089 bp

cDNA Sequence

ATGGAATATAGATTTTTAGGAAACACTGGTCTCAAAGTCTCAGCTATCGGTTTCGGAAACTGGTTGAATAGTGATACTTCTGATAGATAACAAAAAATGATTGAACTCGTTAAGAGAGCCTACAGCCTTGGAATCAATTTCTTTGATACAGCTGAAGTTTATGGCTTTGGAGAAGGTGAAATCTAATTTGGAGAAGCCTTCAAAGCTCTAGGAGCTCCTAGACAAGAATTAGTCATCTCTTCTAAGATCTTCTGGGCAGTTCCACCAACCTCATCTGATCTTAAAAAAGTTAACTAAATTGGTTTATCTCGTAAGCATATTTTCGAAGGAGTGAAAGCCAGTTTAAAGAGACTTCAATTAGACTACTTAGATGTTGTCTTTTGCCATAGATTTGATGAAGATACTCCCTTAGAAGAAACTGCTAAAGCCTTTAACGATTTAATCGAATAAGGACTTATTCATTACTGGGGAACCTCAGAATGGTCAGCTAGTGAGATCTTTGAAGTCAGAGAAGTTTGTGCTAGATTAAATCTCACCCCTCCCGTTTCTGAACAACCATAATATAGTATGATGGTTAGAGATAAATTTGAAGTTGAATACGGAAGACTCTTTGACAAGTACAGATTAGGAACTACAGTTTGGAGTCCTCTCTGCAGTGGTATCTTGACTGGAAAGTATAATGATGGAACCCTTCCTGCTGGATCAAGATTATAAGAATTCAAAGATAATATCTTCTTGAAGAGAATTTACGATTAATACTTTGCTGAAGATAAGAAAGAAAAGTTATTAAAGCTCCTTAATGGCCTTGCAAGTGTAGCAAAGAAGTTAGGATGCACTTAGTCATAATTAGCTATGGCTTGGGTTCTTGCTAATCATGATGTTTCTACTGCAATTACAAGTGCTACTAGACCTGAATAGATTGATGATATTGTTAAATCAGTGGAAGTTATCAAGAAAATAACACCTGAAGTGAACAAAGAAATTGACGAGATATTAGGAAACAAGCCTATGCCTGGAATGGATGTTAAATCATTTGGACTTAAAAAACACACAAGAAGAGAATTGATGATTATTAAAAATTAATATTGA