TTHERM_00966510

Length: 1737 bp

cDNA Sequence

ATGGATAAAATTACCATCTAAAGTCTTAAATGCAATAAGCATCCAAATAAAAACCTCCAATTTATTTAAGTAAATGATGTCCTAACACAACCTGTTTCCAATAAACCTCTCTTTTACTGCTCTTCCTGTTTTAATCACGATCTTCACTTTAAATCTATCAACTATCTTATGATTGACCAGATTTTTTAAGAAGCAGAAACTAACATCATCCCAAAATGGCCACCAGTCAACAACTATCAAATCATCTCAGATCTCATTGATCTTAATTCCAATTAATCTTCACTTGACTATGTCAAGCAAATTACAGACTTCTTTAATTAATTCAAAGAAGAGTTTTTAAATAAAATAGATATCATCTAAAAATAGACTATCAATGAAGCTTTGAAATATCCTATTGATACACAACAAATCATCAAAAGATATTAGGAAATTTCAAACATTCTTTAGTTTAAGTAGATTCTTAACAACGAATAATCAAATAACCTTCAAGATCATTCAACTCTTTGTAAAGAATTTATCTCATAAATGGAGTCTCAAAAAGATAAAAACACTGAATTATTGTAAAGTCTACTTACCTAAGCAAATTAATTAAAAACAAATTTCAACATGGAATATCCTCAGATCATTAAATAATAATTATTTACTTTTATTGATAACATTTCTTTCTTCAATTTAGGTATTCCTGAAGTTAGTAGTACAAATCATAATAACACTGGAAATCATTAGGAAACTAACATTATAAATCAAAGTAATTTTGGAGATTTAAAACTAACATCTGACTTAATCATGAAGCTTGTTTCTAATAAATCAAACTTTTGCTCTGACTAATTCTTAAACAAGCTAAGTGAGATTCTTTAAAGAATAAACCCTCTACTTAAATAGTTTACTTTCAACACAGCAGTTTTCAAGGAGAACAAAGAACAAATTGATTTTTCCAAGATTAGTGAGGAAAAAATAAATTTGATAGAAGAATATGTAAAGCATTCAATTGCTTTGTCAAGAGGGGAATAGTAATATGAATAGGAAGTAAAGGATAGTTTAGAAATCAAATAAATGACTTAAATTGTAGATTCTAAAATGAGTTTCTTGAAGTAAGAATTCATATAATAATTTGAAAAGTTCTTAGTTGATGTAAAACCTTTCTTAAAATAGATTAATTTCACTAATACTTTTACTGACAAAAATAAATTTGATTAATTCAGAAAAAAATATTTGAAAGATAAATAATTGTGTGTTTTATTTGATGAAATTTAATTCATTTCAGATCTAAAATTGTTTGCAACTTAGTTTAAGAATGGGTAGAGAGATAGTGTGGTAAATAAGAGAGAAAATGGTTATTATGAAATTGAAAAATTAAATAATAATGATTGGGTGAATTGTCTAATGAGAAATTTAAATGCTGATTTAAAAGTAGGATATAATGATTATTTAAGTTGTTACTTAAAGAAAAATAATCAATCTGTAATTAAACATGGAGGTTTGGGTATAGATAAATAATTAAAGGGAGCAGGATTTAAGACGAGTGGAGAGAATATGATAGAACTAAGATTGTGCTTGAAAGAGTAGATTTTAGAAGTGTTAGATTATCCTAATTATGAGTATAAGCTAGGATTACAAGATTAATATAAAGAGAAGCTTACATAATTTGATGATCTAAGATTTTATCTTGGTATTTATGATTAAGGAAGCAAATTAATTTTAATGGATGTAAAAATAGTGAACGAGTTTATAATTTGA