TTHERM_00974260

Length: 1686 bp

cDNA Sequence

ATGATACTAAAATAGCTAATTAAGTATTAATTCTCGAACATTCGTCCTATGAGAGTTAAATACGTTTTGCAGAGTAATCACACTATGTTTAATCTAAATCATTTTAGGAGTGCTTTGGCTGCATATTACTATGCTAGATCCAATGGAGCCTCTTTTATCCTCCATCTGGACGACATTAAGGATTAATCGGATCACCTAGATTTTAGAGATCTCTATACAGGGATATTAAAGTAGTGTATTAATTGGGACGAAGGATATCAAAATTAGTATGAAGAGGAGGGACAACTTGGTCCTTACGAAAGCTCTAAAAAATTAGATAGATATAAAGAAATTGCTGAATAACTGATAAAAGAAGGAAAAGCTTATAGATGCTTTTGTGATAAAGAAACTCATATTCAATAAAATAACTTAATTTATAAAAATAACAAAATACCATAATATAGCGGAGTATGTAGAAATTTAACAGAAGAATAGATCCAAAAGAAATTAAATGACAAAGTTGAATATTGCATAAGACTCAAAACTGATGAACTTACCAGAGACCCATATAAGAAGATATTTTATAAAGATGAAATATAGCTAAATCCTTTTATTTATCAAGCCTTTTTGTATGACATGATTATTTTTAAAACAAATGGTTAGCCATCAAAATTCTTTAGCTTTTCCATAGACGACATAGATCAAAAAATAACTCATGTTGTTAGAAATTAAGAATGGATGAAAGACATCCCTAAGTAGCAAGTTATTTACTAACTTTTAAATCATTAAGATCAACCTAAGTTTTTCCATTTGCCGAATATGCTTGATAGTAATCATAGATACTTCAAGAACGAAGAATTATTTAGATACTTTTAAGTTAAAGATTTTATTAAATAAGGAGTTTCAATTCAAGCTTTAGCTAACTTTGTCATTACCTAAATATGGAGAAACTAGGTTGTCAATTAAAAAATCAAGTAACTCAAAGAAGAAGGTAAAACTTAAGATGAAATATATGCCCTTGAATTATACTCACCTGAATATCTCATGAATAGCTTCACTATGCAAGATGTTAAACAAGAAAGCTTTGAATATGACTAGCTAAAATTGAATTACTTCAATAGATACTTCATACGCCAAAAATATATGCCTCTTTTTGGAGACGATATTAGTTAAAAATAAAGTGATAAGCTTATCAATGAATTTAGGGAAATTCTCATTTAGCAATTAGGCCCTGACTTCTAGGAAGCTATAGACAGAGTTAAAGATAAAAACATAGTGCAGATTATAGAAATAGTAACTAACAGAATTAGAAAATATGAAGATCTTAGTTCTTACCCATTCTTTTTTACTGATCCTACTTATAACACTCAAAGGGAAAAATCCTCTAGAGAATTAGTTTTTAAAGATCCTGTAATAAACCAAAAATATGCACAAGTAATCAAAGATATGATAAATATTTATAATAAAAAACTTGCTGACAGCTAGTTTGATGAGTCAAATATTAACAAATAAATTTCTTATTACATTAAAAATGTAAATTCAAAGCTAGATAAAGACGTTTATTATAAATTTTTGAGATTCACATTAACAGGATATCATTAATCTCACGCTATAGGTCTTGTTTCATAAATTATTGGAAAATCTGCATGTTTGAGAAGACTCAGAAATATGTAAAAGCTATTAGAGGAAGTACCCTAATAAGAATGA