TTHERM_00985160

Length: 2619 bp

cDNA Sequence

ATGTCAAGGCGTAACTAAAAAAAGCCATAGGCTCCTATAGGCAATGAAACAAATCTTGATTTTGTATTACAAAATCTAGAAGTTTACAAAAGCCAGATTGAGCATTATAAGACCTAGTAGTAATAGATCAAAGAGGAGGATCTCAAGCTTTTAAAGTTCAAAAATTAAGATTAGGATGGAAACTCTGGCAACGATGATGATGATGAAGAAAACAACTCAAATAAATAATAAGAATTATTAAGGAGAGTCAATTAGATTAAGTAGCAAGTTTAATTGATAAAAAAAGTTGGTTCTAAGGTAGAGAAAGATTTGAATTTGAACGAAGATGAAAACAAAAAGAATGGACTTTCTGAATAGCAAGTGAAAGAAGAGTAATTAAGAACGATTACTGAAGAATAGGTTAAGTATTAAAATTTAGTATTTAACATGGACTACCAGTTAGATTTAAATGAGAGTGGTGGCCATAGAAGACACAGAAGAGAAACAGATTATGATACTGAAAAATGGTTTGAAATATCTCATGACCAAAAAAATTATGTATCAATTTACGCCAACTAAAAGACATCATATTGTTGGTGGCTTAAAGATTATTTTAATAAAAACAATTATGATCATCTTAATGTAAGCATTAACAGACTAGAAACTGAAGCCGAATTCTATGCCTTTGATGATTTTTCACAAACAATCAAACTTACTAATAATTCTTACTAGACTGTTAACATAGACGTTAATTTTGATAATAATCTCTGTATACTCGCATTGCTTAGATTTTTATTATCACTAGAAAGATTCAATATTTTGAATATAAGATCTTCTTATACAAGAAATTAATATAATTTTGAGAAAATTGGTGAGCTACTTGAAACTATCTTCGCAGTTGTCTTTTCTCATCGCCACTTACAAGGCATTCATTTACAAGTTCCTTGCGAAGCGTTCTAATATTTAGTTAACTCCTCATCATAAATTAGCGTTAAAGATAGCTAATTATAGGTATACTCTTTCTCTACAGACTTAAAATTAGTTGACACTAACAAAGTCCAAGATTATTTTAAGTTCTTATAAGAATTCCCTCGTTTGACTCATGTAAGCTAGTAGGCTATCCCAGTTAGTGCTACTAACGCTGTAGAGAACCTCAATGTTTTACTTAAAAAGGTCAAGCATGCTAATCTTAATTTAGTTTCTATCCCTACCTAATTCAATTTTGATTTCTACTTTGTTAATTTATAACATTTGAAATTAGAGTTTGGATTAGAACCAAATATTTTGACAAAACAAAAGCTTGAAAATCTACTTTTGAGTATAAAATAATCAAAAAATCTTAAATTTTTAAGATTAAACTTTTACACCTACGTTGCTTAAGAAACCTCCAGAAAACAGATATTAAAACAAGCTACAACAATCAAAAATCTCAAAAACAATAAAAATCAAGAAGAAACTCCTGAAACTAAAGATGAAACTCCAAGCGAAAGCACAAGTGGTATGAAATTTTTTGATCATCTTTCTGAATTAACCGAGCTTGAAGATTTCAGCGTTAACTTGTAAGCTACCCAAGAAATTTATGATAGCTTGCACAAACTTTTGATTAGATCAACAAATTTAAAGAAGTTCAAATTAAGTTACAAATATGAAATGGAAAAGAGTAAAATGGATACATTCATAGATCTTAAGAATATTTATGAAACCTTAAACAATCTTAAAAGATGCTCTGTTAATATATCAAATCCTCATGGAAACATTTCTTATGAACTGACAAATAAAGATTCTACTTTTTATAAATTTAAGCTGACCTTAAACTAAGAATTATAACACGCTAAGTATACTTTTAAGTAGAACGAATTTTAATTTAATAACGTTAAAAGTGCAAAAATTGAATCTTCCTCATTAGAAAGCTTAGAAGATATTGATAGTCTTTGCAAATCTATTGCTTCTTGTAAAAATTTACAAAATGTTAATATTATCGCCAGTTTGCTCTATCCCAACAATATTTAGAAAAATCCTTTCAATAAGCCCAATCTTCTATTTTTCAAGCAATTTGAATAATTGAAAAATTTGGAAAATGTATCTATCAACTGTATTCTTGATCAGCATATACTTAATTCTATTTCAGAATTCTTAGAAAAGAATAAAAAAATAAAAGCATTCATTTTGAAAAGATATTATTTATTACAATATTATCTTGATTATACTAAATTATTTAAAACACTTCAATAGTTACCTGAATTAAATTAAGTTTACATTAATTAGCAATTAGAAGAATTGACTGTGAGTGAAGTACATAAGTAAGTATGGGAAAACCACAAGCAAAAAGCTTTCTATGAACCATTATGTGAGTTTATCAAAGAATCATCCTAAACCCTTTAGCTAATAGATTTTGACCAAAACACTGTAAGTGATGACTCTATTAAAAAGATTTTAGAATCTATATCTGAGTCTAAGTATCATCATTATTTGAGATTGAACCCTAGTTAATCTAGCAGTTTAATTAAATCTGAAAACGAAGAAATTTAAGAACTTCTCAAAGCTTGCGACGAAAAAGGTGTTTTAGTAAAAGCATACTATAAATTCCCTCTATGTTTACCAACTGGTACTTATTACGATTACAATTCAGATAGATGGTGA