TTHERM_00997610

Length: 867 bp

cDNA Sequence

ATGGCAGCTGCTTTATTAGCATCTGGAATAGATCCCAAAAAATCTAACATTTTCGTTTAATCAGCTGTTCCTTATCATGCAGAGCTTTAATGGATGTTAGGATGTATTGCTCCTCAAAATTGGTTAAATACAATGACTTAATATAAAGATAAAAAATCAAAAAACTCTAGTTTGGGTTTATATTCTTACCCTGTTCTCATGGCAGCTGATATTTTACTTTACAATGCTACTCATGTTCCTGTTGGAAGCGATTAAAAGCAGCATTTAGAGTTAACTAGAGACTATGCTACAAGGTTCAATACATTATTTAAAAATGATAAAACATAGGGTATTTCAATGCCTTAATACATAGAATGTAATTCAATAAAATTCCATGAAATAGTTAATTTAATATAAATTTTTTAAATAATACAAGCTGAATTTCCTAGAGTAATGAGTCTTAAAGATGGTACTAAAAAAATGTCTAAATCAGATCCTAGTGATTTTTCTAGAATTAACTTGACTGATACTCCTGAAGTAGTTTATGACAAGATCAAAAAAGCTAAAACTGACTCAATCCCTATTGTTAAATTAGATCCAAACAGACCTGAAGTAACTAATCTTATTAGAATATATAGCTCTTTATCTGGTTAGAGTATCAAAGAAATTGAAGCTACTTTTTCATCAAGCTCTATGAAAGATTTTAAAGACAAACTCTCTGAGCTTATTATTACAAAAGTTTGCCCAATTGGTTTAAGAATAGAAGATCTATTATCAAACTAAGACTACGTTTACGAGTCTTTAAAGCAAGGTAACGAAAGAGCTTACGATAGAGCCAAAGAAAATATTCAAAGAATAAAAAAAGAGATGGGAATGTATGTTATGTGA