TTHERM_01005070

Length: 3579 bp

cDNA Sequence

ATGAGTAAAAATATTCTGCAAAAATACAAATCAACTGTTTCAAATGGCGGCAGGAATGTTGCAAGATAAGATTCATCCAAAATAAGCATAATGCAATAAAATTTATCACCTGTTTACAATTCATTAGATTTTAATAAGATAGGCAATACAAATAGCAATTCAAACAGACCTAGTCTTAAATCTGATTTTCGAAATAGCACAATTAAGAAACCTACAAATCTGCTTCCTATTGATTCAGTTCGTTATGAAGGTGATGTAGATGCAGATGGAGATGTGTAATCTTAAGTAATTAAAAGCAACAATATTAGAGAAGGGTTTTTAAAAGTGAAATTAAAAGGTATAATTTAGAGAATGGCTAAATATACAACAAGTAGGATGTATAAGAATTTAACTTTTTAACAACTTAAAATGATAGATGATAAAGCTTATGACTCAATAGAGTATTTAGGATAAAAATCTGGATTTATACGATACTAAAAATTAGGCAACACTTTTTAAGACAGATAGCACATATTTTAATCTTACTGCAAGAATAATTTATTTACAGATTTAATTGGTTTTATCTCAATTTTAATTTTGCTTATTATTGATAAGAATGGGAATAAGTTCTCATAAAATTATCCAGATCTTTACAGCTTCGTAAAGCTGATATTTTTTATACCCTTCTCCATTAAATTTAAAGATTTTGGATAACTGATACAGAAACTAGAAGAAAAAATAATGTTTAAATAAAAAATGTAACACATTGTTCAGATAGTTAGACTATTCTCGTTAATTATTATGATCAACCATATTTTAGCATGTATTTGGATATTTAATGCGCAAATAAAAAATAACGAAAATATCAATTGGATAACCTCAAAAAATGTATAAAACGAGACTTGGATTTATCAGTATGTTATGTCTTTCTATTTCTGCACTGTCACGATGACAACAGTTGGCTATGGAGATATTACAGCTAAAAATTTTTCAGAATATATACTTTCGATTTTGATGATGCTTACCTCAAGTGGTGTGTTTGGATTCAGTCTCAACCAAATAGGTACTATCTTTACAGATTTTTACTCTTAAGACAAGGAAAGAAAAAAGAAATTAAATATTATAAATTTGCACATGGAGAAGAAAAACGTGAATCAAAATTTAAGATCTCAAATACGTGAATACCTAGAATATGTATGGTAAGAAAATGATGAAAAATTCTAAAACGACAGTGCTTCTATTATTTCTCAACTAAATGAAGACCTGAAAAAAGAATTATATTTACACTAAAACAGGAGAATAATCAATTACCTAGAGCAGCATTTTACAAATGAATTCATTCAAAAGGCTATATTACTAATTTAGGAGTAAAAGTGTAAGCCATAGTAAAAAATTTAGACGTCATCTGACGATCTGAGTCTCTATCTCATTGAAAAAGGATAAGTTGAGATGTATATCACCCCAAATACAAACCAATACACAACAAAATCAATTTAAGGACAAATGTTTGGTATTAGCGAGTTTTATACAGGCGAGTGCAGAGATATCTTCGCGAAGGCTATAGGATTCGTCAACTTAATTAAAATTTCAAGAAATGATTTTATTAAATCTCTTTAGGAATTTCCGAGAGATATGGAAATGTTTAATTATCTTAAAGATAGAAGAATTTTTAATAAAGATTTTGCTAAAATTGGGGAAACTTGTATAAGTTGTGATAGTAATGAACATGTGGTTACTAATTGTAATTACCTGCACTTTGTCCCATACCGCTCAAAAGTTATAACCAGACATAATTTTGAACTTCCATTTGATAATAAAAGAAAAAAGAGTTGGAATTAAGGATAAATCGTAGAGAAAAAGCGCAGGGGATATAAAACAACTAGAGAAATAGTTCAATTAGATGATTAAAGATATGAATTGTTTGCATATGAGTTCTTTGGAATGCTAGACGATTACGAATAAAAATTCTTATGCTATAATTTTAACTATAACTATACTTCACCATATCTTGCATTTTCTGATGACGATGAAGATGAGGAAGAAGGGGAAGTCTAAAATGGATCAGCTCTGCTTCATAGTGGAAATAATATAAATCACTAAATAAACTATTAAACAAGCTGCTTAAAAGAAAGGTCTAATAGTTTTGTTACTAATCACAACAATCACAGCAGTACTCCCATTAATAATTAACAATTTTACACATAACGTCTCTCAACATTTGAGAAAGTCCCCTCCATTAATGGAGATACAGCTGTAAATACGCCTCCAATTTTAACAACAAACCTAAATGGTAAAAGTTCTACTAACATTAGTACCAACCCACCGTAGATAAACTTAAGCTAAAGCAGAAACTTAGATTAATCACCAATAAATAGGAGAAAATCTATGCTTAAATAATTAACACCACTGATTGTTACAACTTAGGCTACAAATTTTGAAAATTTCATTTAATTAACAGAACAAAAACCTCAGAGAGTAATCTACACAAGAAATTCTAAAAAGATTAAGACCAGTTAATAAATTTAGCAAGCAGTAAATAGTCCAGTAAAAGAGTCTAATTTTCACAATCCACAATAAATCTATTAAAATAATTCAAAAGAAATAAATAAAACAAGTGATTCACTTGATCACCAAAAATCAATAGAGGTTTAGAGATAGTTATCTCATACTAACGATCATCATTTTAATTCATAAAACTCTCTCAAGCACTAAGTTTCAAATTAGCAAATCTCTAATTAGTTGATGCAATTTTAAAGGTCTATAATGTAAAACCTCAAAACAATAATAAGAACTTCAAATGTATAGAATACAATAACAAAAACGAATGTGACAGAAGAATAGAACCACCATTTTGGAATGATTTAAATATTTTAGTCATTTGATAAATAAAAAGATTTCTAGGTTTACTATCCATTGAACAATCTTAGCTTCATATTGTATAACCTAAAAAACAAAAAATAACTAACCCGAAATTAGTATCTTACATTGATTTAAAATGCAAGCAAGAGTAAAAATTAAATTACTTCCTACAACTCTTTACTCAAGGCTAAAATAGAAGTAATTAATGGAAGTAAAAAAGAATAAACTATGAAAAAGGCCTTTACTCTAAAGCATTTGAGCTTTCACAGTAATCTCTAAAACACGGCATCATTTGATAATTATTCTCAAATAAAAGAAATACAAAACAGCTAAAAAAATCAATCAAATAATAATAATAATTCTAATCTAAACTTTAATAGTAATATAAATCTAAACAGTAATAACAATATATCAAATTATAAAAAATCTGTTTATTCTAACAAACATATTCCTTTACCCGATTAGCCTATTTAAGTACCTGATATGTTAATTCCTATTTGGTCTAGTGAAAGACAGATTCAAACTGCCCGATCACCAACAATCAGAAGTAAAATAAATGGCTAAGATTTAATTCTAAACAAAACAGAATTATCAATAAGTGATACTGATTACATTAGGAATATGTCACTTTAATCTCCTAACGTTTAAGAAGAAGTTAACGAAAATAGCTAAACGAACATGAAGATCCTAGTTAAAAATTTTAATACAGTAAAAAATAGTGAATATTTTATAAAAGAATGA