TTHERM_01005160

Length: 1293 bp

cDNA Sequence

ATGTCTAAATTATTAGCTTTAGCTTTAATACTCTCACTTTTAGGTACTGCTTTAGCTCTTTATGACAATAACTCTAAAGTCATTAAGCTCAACAAAAGCAGATTTTAAAACGAAGTCATTAACTCAAAAGAACTTTGGCTTGTTGAATTCTTTGCCCCTTGGTGTGGTCACTGTAAGAGCTTGGCTCCTGAATGGGAAAAGGCTGCTAAGGCCCTTGAAGGTATCGTAAAAGTCGGTGCTGTTGATATGACTACTGATCAAGAAGTTGGAAGCCCTTACAACATTTAAGGTTTCCCCACTATCAAGTTCTTTGGTGATAATAAGTCTAAGCCCTAAGATTACAACAGTGGAAGAACAGCAAATGATTTAATTAACTACGCCTTAAATGAAGCTAAGAGTATTGCTCAACGTCGTTTGAGTGGTGGAAGCAGCTCATCTGGAAACAGATAATCAGGAGGCTCTAAGGGTAATGCTAATGCTGATAATGATGGTGATGTTGTTGTTTTAACCGATGATAACTTTGATGCCAATGTAGTTGGAAGCAAAGAACCTTGGTTCATTGAATTTTATGCCCCTTGGTGTGGTCACTGCAAGAATTTATAACCTGAATGGAATAAGTTAGCTACTGAAATGAAGACTGAAGGTGTTAAGGTTGCTAAGGTTGATGCTACAGTACATCCTAAAGTTGCTCAACGTTTTGGAGTTAATGGTTATCCCACCATTAAATTCTTCCCTGCCGGTTTCTCCAGTGACTCTGAAGCTGTTGATTACAATGGTGGCAGAGATGCTTCTTCATTGGGAAGCTGGGCTAAGGAGCAAAGAGATGCTAAAAAACCTATTATGTTCACTCAACTTCTCAATCAATCTATTTATGATGAATACTGCACTAACAACTCTGGTGTTTGCATTATCTTCCTTCTTCCTCATATTTATGATTCTTCTGCAGCTCAAAGAAATGGATACATCAATTTAATTACTGAAATCGCCCAAGCTAATAAGGGAAGACCTATTACTTACTTATGGAGTTAAGGTGGTGATTAATACGATTTCGAAGAAAAGCTTAATGCTGGAGGCAGTGGTTATCCTTCTGCTATGGCAATTTCTCATAAGAAAAATCTCTACCAAATCTTTAAAGGTTCTTTCAAGAAGAAAGACTTAGATAGCTTCATTTCTGGATTACTAACTGGTCGTGGTAGCTTCTCTACTTTACCTACTCTTCCTAAAATCAAAAAGGTTAAGGAATGGGATGGTTAAGATGCTGAATAATAACAAACTGATAACAGCGATCTTTGA