TTHERM_01013140

Length: 1695 bp

cDNA Sequence

ATGGATAAGAAAGATGTTCAATAGACAACATTTGATTTTGTATTTGATGCTCCTATCTACTCAGAATTTCTACCTAATAAAGACATGAATTATTATGATCCTTTGAAGACAAAAATAAATGAGAAAAGCGAGCTTGACTAGTGGTTCTTAGTTTATCATGATGATCATTACTAAAATAAGGGTTAAAAGTCTAGGGGGAAAAAAAATGATAAAAATTAATTAGATAATAAGGTATTTCCTTTCGTAAGATCAAAGGGTGATTAATTGCCTAAGACTAAAAAGAGAAAATAAATTAGCACTGATGATTATTAGTAAAAACTTGAAAAAATATAATCTTAATAATTGCCTTTAAAGCAGTAATCAAAATAGATTAAGAGGCAAACTAGCAATTTACCTGGAGTTGAGAAGCCCAATGAAACTAATAATGTTTAATAAAGCATGAGAAGAAATTCTAAAGATGATAAATAAATTGTTTCTAATACTATTAAAAATATTCCTGAGAGGAAAAACAGAATTAGTACTTAAAGTAGTAGCTAAGTTAATAGAGTAACCAGATCGAAATCAAATAGCAAAGATATTAAATCTTTCTAAGAAATACCTGCCTCTATAAAATCTTTGAAGCAAGTGAAAACTGAATAGCCTTTGAACTAAAAATAAAAAAATAATTAAGGATAAAAAATGATCGTTGAATTTGAGTCAAGATCAAATGATAGCACTTAGTAAGAAAACTCTCAAGAAACTAAAAAAACTGGGATTTTAGATTCAAAACTCTAAGTTATAAATGAAAAGTAAGATGCAGAGACTATTTAAGTTGACGTTCTATCGGACAACAATAAGATTAATTGGAAAGGTTCAAAATAAAAAGATAATAATTCATCTATAATGGAGGAATGTCCATCTAGTAAGGCAAGCAAAAAATCTGGAATCAATTTGGCTGACAACAAGGTAGAATTAACTTAAAATAATAATTAGAATTAGAATAATAACTTAAACTGTGACTTTGTGAATAAATTAATTAATGACTCTCTTTTTAATAATAAAAGCACAATGTAGTTGGCCTAAGAGATGGCAAGCTAAAAAAGCCATAATAGAATATATAGCAACATAGAAGAAGTAGATCAAGCAACTAAATAATCTGATAGCAGTAATTCTTGCATAACTAATTTATTCAATTAAATAGATACTTAAATAAATAATCAATTACTAATCACTCCACATAAAAATACTATATGTGCTGAAAATAAAATAAATCTAAAAGGCTCTACTCCTCTTTTATCCAGCCATTCGAGAGAAGATCCTACTGCAGTTTTCTTAAAGCTTTAATAAATAAATGAAGATGCATTTTAAAAATCTTAGAGAACTAGAACTAACAAGAACAAATTATTAGTTTCTGAAGATAAAAATTAACTTTCTTAGTATAAAAGACATTAGTCTTTGAATATAAGCAAACCTAGAAAGAGTATTATTTTAGATAATAGCGTTTTAGCAATTTCACATAAAAGAAAATCTGAAGTTGTAAGTGTAAAGAGAAGTAAATCAATAGATGAGTAAAGATAAGATCAGCAAATGAAGGAATTTGAGAAGGATTGGGAGAAGAAAAATGGAGTTAAATTATATATGTTAAATTATTAAAAGAGAAAGGAAATTAAATAATTATTTTTGAACTAAGAGAAAGACAAAGTAAATATTTTTTGA