TTHERM_01027710

Length: 1446 bp

cDNA Sequence

ATGAATTATGAAGATTTAGAAAAAAATGTTAAAATTTTTGAAAGTGAAATGATTAGAAAAAATATGAAAGCCTTTACAAAAATTGATGAGGTTGAAGTAAATTATTTGAATGATAAAAGAGTTTCACCTAAAATGATTGATGAAATTACTCTTGATTTAGTTAAGCAGAGTCCTACTATGCTACATTTATTTTAAAATATTATAAATAGCTTAAAGCGTTTTGAGTAGAGTGGAATGTATAAGTAAGTTGAGGTAGAGCTTCTTCCTGGTTCTAAGAAAGACTCTGTCCTTGTATAATATCGTTTTATGCCTTCTTCTTTCTATTTTGCTAACATTTCTCACTAATTTGATAGATTTGGTCAAGCTTCCATGACTACAAAATTAGGATTCAGAAATGTATTAGGCTTATTTGATAAGCTAACGTTTGAATACAATAAGGCATTAAATAAATCTAAAAGAAGCTATTATAATATTTAATGGAATGTTCCTTACAACTTCTTAAAAAGTAAAGCAGAAGACAATTTTTTGGCTTAGATTTCTCATTCTTCAACTTTGTTAGATTAATCTTGCTCTGAAACTAAGGACTCATGCTAAATTATTTACACTAATATCGATAATAAGAATGAATAAGAAAAATACAGCCTCAGTTTTGAATCTGCTTATCGTAGAAATTATGTCACTTTGCCTTTATACAGAAATCTCGAAGATTTTCTTCCTACCACAAAGCATTCCATCCGCTATGCAACAACTGCTTTCTCAACAATAAAAATGGGATCTAATGTCCACAAAGGATCATCTTTGAATTACTCTCTTGAGTTTGGACTTCCTCTTTTAAGTGATGTAGTATTTCTTAAAACAGAAGCAAACTACAAAGCTTATTGGAAGCTCAAAACTCTCAAAAAAGTATCAGATATGTTTAAGCATGTAAATATAGAATACAGTGGAAACCTAGGTTTAGTGAAAACTTTAAATAATGATAAACTGCATCTTAATGAATGCTTTTAATTGAGCACAATTAGAGGAGTAAATGACATTAATGTAGACTATATACCTTAAGGTGATTAATAAATTAATCAGTAGCAACCTCCACACAATATCTCTAACTTTTTAAAAGATAATCTTAATTTATAGTTAAAATCATCGATAAAATTAAATTTATATAATTTCCCAGGTACTTCAAAATCTGGAGTTATCCCATTCTATCATGCGAGTGCAGGATACTTTTATAGAGTAAGAAACGGATATGGAGGTTATCCCTTAAAATCTTTTACCAAAAACGATATTGCTGAGCATTTAAAACATCATTTCCGTGCTAGTGCTGGTATTGGAGTAGGATTAAGCATGGGTCCAAGTACAAAAGTTGAGTTACTATACAATTACTTTTAGTTCTCAAGGCTTTCTGATAATCGTGCCAACATAGAATTAAGAATATCAGTTGACGATTGA