TTHERM_01030000

Length: 3597 bp

cDNA Sequence

ATGGATGAAATATTGTAGTAATTTATAGATAGCAAAAGATAAGCAAAGAAGATAGAAGATTTTGCAGACGCTGTATCATGCAGTGCCACAGAAAGCTTAGAAGATTAGGACTAATCTTTTGATAGAGGTGCTGATTTCAACGATGGAGAAGTAGATGATGCTTTATTGGATGAACTTATAGAATATTAAACAAACAGAGAGCGTTAATCAATTACTGAAGAGTAAAATGATCTCATGAAAACTGAATTGTAAAAGCCAATAAGCAACAATTTAAATAAAAAATAACCAACTAGCTTGAGCGGTTTGCAAAAAGGGTTAGGAAACAAAATATCTGGACCTTCTTATGATTTTAGTAACTCTAATAATATGTAGACATTAAGCGGCATTTATAGTTCAAATTCTAACAATAACTCTTAGAACAGCAATGAGAACTTTAATTTCAATAGACAAGGAAATACTACTCTAAAGCCTACGGGTTTTGATGCTATCAAGCTTAAAAAAAATTAGAATTAAGATTAATAGTAATAATAATAGCAATAGCAAGTTCTGAAATTTGTAAATTAAAATAGTAATGGAGGGATTTAAGTAGAGGCTTCTTTAACAGATAAAAGAAGATAAGTAAATAACTCTAATGATATTGATAGTTTCATGTTGATCAATAACGGATAAAAAGAAAAAAAGACAAAAAATTAAAATTCTAAAATAAGTGAGTTGCTTGAGAAGTACAAAGTGATAGATTCTAATTCAAATACTTAAAATTTCGAGTCTACTTCGCTTAATACTTCTCTCAATACCAAAAATAATAAATTAGAAGTTAAAAATGGGTTTTAAAATTTACCACAAAAAACTGAAAAAATAGGGCTTGCAGCCTAAGCTGTAAATCAAAGCTCTAACGTACGTTCTAATTTTACACCTCCTACAATAGTCAATAGAAATAATTGGACAAATAATTTATCCAATGGGCCAGGTAGTGCACTCACTGCATCTTCTACTGCAAAAAAGCAAGCTGACATAAAGGATGTTGATTATTCAACCTTAGATTATTTGAATTAACCAGAAAGACCATTTGTTCCTCTTGAATCTAAAAATAAAGGAAAACATGTCTCTAAAAGTAACTAATACTACACAGTTGCAGATATTAATGAATATGCAATAAAACCACATCCTTGGGATCAGAAGGTTAATGATATATTAGCTAACGTCTATGGCTATAAAAATTTTAGAAATAATTAAAGAGCAATTATAAATTGTGTCTTGGAGAATAAAGATGTGTTTGCAATGATGCCCACTGGAGGTGGCAAATCTCTTACATTTTAAATACCTGGACTTGTCTAAGATGGAGTTTATATTGTTATTATGCCTCTTATTTCACTTATTTCTGATTAATACAATCACATGCTTAGGCTCAATATTCCAGTTATCAGAGTTTAAGGAGCTAGGAAGAACTACTAAAGAGAATTAGATTCAATACTTTATTCAGATAAGAATTAGTCTAAAATTGTGTTAATCACACCAGAAAAAATATCATCAGATGAAGATTTTAACCAATTTTTAAGCTAAATTTATGAAAAAAATAAATTGAGAAGATTTGTTATTGATGAAGCTCACTGTGTTTCTTAATGGGGACACGAGTTTAGAAAAGATTATCTTTCTTTAGGATAGTTAAAAATAAAATATCCAAACATTCCTACACTTGCTCTAACTGCTACAGCTACTGAAAAGTGCAAAATAGATATTATTTAACTTCTTAATATGAAAGGAACTCTGTATTTTTAATCTTCTTTTAATCGTACAAATCTTTACTACGATGTAGTAAGGATACCCTAAAAAGTAACAATCGAGCATATGGTTAATTTTATCAAAGAAAAGTTTAATAAGCAAAGTGGTATTATATATTGCTGCACAAAAAAAGACTCAGAAGAATTAGCTAGTAAGCTAAATATATAATATAAAATTAATGCAGCATATTATCACGGATCTATGAATGACAAAGAAAAAGAATAAGTTCAATAACTTTGGATGTCAAATGATATTTAAGTAATATGTGCCACAATAGCTTTTGGTATGGGTATCGACAAGCATGATGTCAGATTTGTCATCCATTATACTTTTTCTAAATCTATCGAAAATTACTATTAAGAAGCAGGTAGAGCAGGAAGAGATGGTAAAATATCTCACTGCAGAATTTACTACTCTCCAAAAGATAAAAATTCTTTAGTCTTTTTGATCACTAATAATGAAGGCAGCAATAAATAGAAAAAAGAAGAATGCATGGCTCATTTAAGTAAAATGATAAGATATTGCGAAGATACAATTAATTGTAGAAGGGTTTTGCAATTAGCACACTTGGGTGAAAAATTTGAACCTAAATTTTGCAATAAAATGTGCGATAACTGCAGAAATTAAACTTCTAAAAGCAATATAATACAAAAAGATTTTACTTAAGATTGCAAAAATATACTATAAGAATATTTGAGTATGTATAATAAAAACATACAGCTGACTTAAAAGCAATTAGTAGACGTTCTCAGAGGTAAAAAACTACAAAAAAAGGCAGGTTAAAACCTACTTAAAATGATTGAAAACAGCTCAATCTATAGTCTATTAAAGAATTATGATTAATTAACTGTTGAAAATATTGTTAAAGAAATGATGTCTTAGGGTTATTTGAGTGAAAAAATTAAAAAGTTTCGTGCTTATACTTAAGTATTTCTTGAAGTAGTTAAGTCTAAGTATAATGAGTTATGTAATCCAAACAAAATGACTGACAAAATCATGATCAATTAAGTAGTTTCTCAAAGCTCTAAATCAAAAGTAGATAGTCAATTTTTATTTGACAAAGAATTAATTGATGATATTACAGAATCAGATTTACCTAAAGAGTAAGAATTTTTTGATTAAAATAAAAATCTCATTTTTGATGATGAAGAATCACTATCTTAAATGTCTGAAGGTGATTTAATAGATTTAATTGATCTTGCAAATAAGAATAAAACTTCTTGCAACCAAAATGATTCGTCAGATAACATGTAAGAACTAAATAAATAGTATAGCGAAGATGATTCAGACTTTTAATTTTAAATACCTTCTGAGAGAAACTAATAAAGTAGAAGTGGGATTATTTATGAAGAAAATGATGAATAAAATTAAATTGGTCAAGCATATAGTGAGGATTATAACAGTCAAAATAAATAAGCTAATGAAAAACTAAACTAAGAACAGATATAAATTGAAGAGGATGATGATGACGATGATGACGACGATGATGATATTTTACAAATAGCAGCTAAAACAAATCTTTTAGAATAAATAAAAAAATAAAACACGATGAGTGTAGAAAAATAAAATAGTTTGAAAGAAAATTATCTTTATAAATCTCCTCAAGAATAAGATAATTTCTTTTCTGAATTTAAATTAGGCAATAATAACAATAAACCTTAAACTTCTTTAGGATAAACAGGTCATAAGCCACCTTAATAAAACAATTAAAATATGAGCTCATTGAATAATTTTAAATTTTCTACAGGAAACAATAAATTAAAATAAGACTAAGCTGATCTTTTTTCATTTAACTTTCAAAAACTTGCAAAAAATTGA